Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31050
Trapped Gene
BC026439 (ENSMUSG00000022366)
Vector Insertion
Chr 15: 57096648 - 57307958
Public Clones (sanger) IST10471G9 (tigm) IST11293E11 (tigm) IST12093F4 (tigm) IST11278H5 (tigm)
IST14453B11 (tigm) IST11742F11 (tigm) IST11742F10 (tigm) IST14554D5 (tigm)
IST12093F4 (tigm) IST14554D5 (tigm) IST11033E7 (tigm) IST11393B9 (tigm)
IST11033E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683077 (Chr15:57307804..57307957 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGTCCTATGCCGCATGAT Chr15:57307904..57307923 60.33 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683077 (Chr15:57307804..57307957 -)
Downstram Exon
ENSMUSE00000518905 (Chr15:57096649..57096716 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGTCCTATGCCGCATGAT Chr15:57307904..57307923 60.33 45 GTTGCACACAGCCAAATCAC Chr15:57096642..57096661 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683078 Chr15:57308910..57309180 TCGGTTGTGAACTTTGTCCA Chr15:57309096..57309115 60.13 45
upstream ENSMUSE00000683077 Chr15:57307804..57307957 AATGTCCTATGCCGCATGAT Chr15:57307904..57307923 60.33 45
upstream ENSMUSE00000518905 Chr15:57096649..57096716 GCTGTGTGCAACAGAAGTCC Chr15:57096656..57096675 59.47 55

*** Putative Vector Insertion (Chr 15: 57096648 - 57307958) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351098 Chr15:57094828..57095243 CATTGCTCGGGTTTCTGATT Chr15:57094945..57094964 60.07 45
downstream ENSMUSE00000719529 Chr15:57094828..57095243 CATTGCTCGGGTTTCTGATT Chr15:57094945..57094964 60.07 45
downstream ENSMUSE00000225742 Chr15:57090632..57090735 CCAAATGTCCTGCCAAAGAC Chr15:57090644..57090663 60.49 50
downstream ENSMUSE00000225736 Chr15:57088030..57088184 GGCAAAGGCACAGTAGGTTC Chr15:57088090..57088109 59.74 55
downstream ENSMUSE00000225728 Chr15:57086642..57086810 AAGTGCCAATCCGAAATCAC Chr15:57086671..57086690 59.94 45
downstream ENSMUSE00000225717 Chr15:57085748..57085871 TGGAGGCAATTCTCTGGAGT Chr15:57085767..57085786 59.8 50
downstream ENSMUSE00000125867 Chr15:57082418..57082533 No primer for this exon
downstream ENSMUSE00000125866 Chr15:57081115..57081329 TCCCAACAGTTGAACATCCA Chr15:57081253..57081272 59.94 45
downstream ENSMUSE00000225701 Chr15:57078994..57079102 TGAAAGCTGCAAAACATCCTT Chr15:57079021..57079041 59.88 38.1
downstream ENSMUSE00000225666 Chr15:57076378..57076581 TGCCAATCGAACAACAGCTA Chr15:57076517..57076536 60.4 45
downstream ENSMUSE00000683079 Chr15:57075361..57075656 ATGGAACCCTGTGGATCTTG Chr15:57075538..57075557 59.78 50
downstream ENSMUSE00000340843 Chr15:57075326..57075656 ATGGAACCCTGTGGATCTTG Chr15:57075538..57075557 59.78 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATAATCGCCTTGCAGCAC Chr15:57286890..57286910 58.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGCAAGAGGCAAAAGACC Chr15:57286906..57286926 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022366