Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31077
Trapped Gene
Tmlhe (ENSMUSG00000079834)
Vector Insertion
Chr NT_165789: 326351 - 332449
Public Clones IST10314A10 (tigm) IST12875D3 (tigm) IST10851G5 (tigm) IST14843A4 (tigm)
IST11646A8 (tigm) IST10217A9 (tigm) IST10618F11 (tigm) IST10139G9 (tigm)
IST10817C8 (tigm) IST13810B3 (tigm) IST10844D2 (tigm) IST13967E8 (tigm)
IST11074G1 (tigm) IST13932D7 (tigm) IST14464F11 (tigm) IST10609D10 (tigm)
IST10417D8 (tigm) IST14446A3 (tigm) IST11054C2 (tigm) IST10314A10 (tigm)
IST13621H1 (tigm) IST12291D6 (tigm) IST13934E4 (tigm) IST14330D9 (tigm)
IST10453B11 (tigm) IST10555B5 (tigm) IST14657C11 (tigm) IST14790H12 (tigm)
IST10405A5 (tigm) IST14159B10 (tigm) IST10901F5 (tigm) IST10286D5 (tigm)
IST12058G2 (tigm) IST10119D5 (tigm) IST10901F5 (tigm) IST14413B2 (tigm)
IST11552A9 (tigm) IST12295G3 (tigm) IST10885G7 (tigm) IST13920F4 (tigm)
IST11986D4 (tigm) IST10382C11 (tigm) IST11418A11 (tigm) IST14248C1 (tigm)
IST14850B4 (tigm) IST13862C7 (tigm) IST12098E2 (tigm) IST15095B10 (tigm)
IST11589B6 (tigm) IST11038A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704934 (ChrNT_165789:326114..326350 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATCACATGATTGGGGTTGG ChrNT_165789:326283..326302 60.44 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704934 (ChrNT_165789:326114..326350 +)
Downstram Exon
ENSMUSE00000704928 (ChrNT_165789:332450..332588 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATCACATGATTGGGGTTGG ChrNT_165789:326283..326302 60.44 45 GTTAGGGTTCGGTGTGCTGT ChrNT_165789:332536..332555 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704952 ChrNT_165789:159647..159773 CTGACAAAGCGGCACTACAG ChrNT_165789:159698..159717 59.66 55
upstream ENSMUSE00000704951 ChrNT_165789:216736..216917 AAGCAGGCTCCGTAATTTGA ChrNT_165789:216766..216785 59.85 45
upstream ENSMUSE00000704943 ChrNT_165789:258247..258423 CACTGTGATGCGCTTTGATT ChrNT_165789:258263..258282 59.87 45
upstream ENSMUSE00000704940 ChrNT_165789:272714..272993 GAAAATGTCCCTCCCACTGA ChrNT_165789:272932..272951 59.9 50
upstream ENSMUSE00000704936 ChrNT_165789:285396..285515 TTCCAGAGGTGACACTGCAT ChrNT_165789:285438..285457 59.26 50
upstream ENSMUSE00000704934 ChrNT_165789:326114..326350 AATCACATGATTGGGGTTGG ChrNT_165789:326283..326302 60.44 45

*** Putative Vector Insertion (Chr NT_165789: 326351 - 332449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000704928 ChrNT_165789:332450..332588 GTTAGGGTTCGGTGTGCTGT ChrNT_165789:332536..332555 60.03 55
downstream ENSMUSE00000704922 ChrNT_165789:333195..334143 CAGCCACAGAGTTGACGGTA ChrNT_165789:333271..333290 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCAGTCTAATCGCCTTGC ChrNT_165789:332394..332414 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATCAGGTGAGTACCAAACAA ChrNT_165789:326345..326367 58.13 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079834