Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3108
Trapped Gene
Sipa1l1 (ENSMUSG00000042700)
Vector Insertion
Chr 12: 83271064 - 83335449
Public Clones (sanger) (sanger) CH0709 (sanger) (sanger) (ggtc) (ggtc)
Ayu21-T213 (egtc) IST14506A3 (tigm) IST14500F10 (tigm) IST13619D6 (tigm)
IST14193F10 (tigm) IST14485C4 (tigm) IST14652D10 (tigm) IST14957C5 (tigm)
IST14102G2 (tigm)
Private Clones OST318222 (lexicon) OST193706 (lexicon) OST123180 (lexicon) OST33400 (lexicon)
OST30033 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471823 (Chr12:83270407..83271063 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGAGCGGAAAGTCAGTGC Chr12:83270479..83270498 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471823 (Chr12:83270407..83271063 +)
Downstram Exon
ENSMUSE00000472867 (Chr12:83335450..83335515 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGAGCGGAAAGTCAGTGC Chr12:83270479..83270498 60.6 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471823 Chr12:83270407..83271063 AGTGAGCGGAAAGTCAGTGC Chr12:83270479..83270498 60.6 55

*** Putative Vector Insertion (Chr 12: 83271064 - 83335449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000472867 Chr12:83335450..83335515 No primer for this exon
downstream ENSMUSE00000653649 Chr12:83392452..83392472 No primer for this exon
downstream ENSMUSE00000447771 Chr12:83412336..83412396 AGCAGCGTCCACACTAATGA Chr12:83412366..83412385 59.47 50
downstream ENSMUSE00000468208 Chr12:83441649..83443486 GGGGTTGAGGTGATATGGTG Chr12:83442197..83442216 60.05 55
downstream ENSMUSE00000448627 Chr12:83458220..83458350 TTTTCCCTTCGAATGCTCAC Chr12:83458289..83458308 60.19 45
downstream ENSMUSE00000247831 Chr12:83463930..83464118 CCTTGCTCGTCCAGTTTCAT Chr12:83464120..83464139 60.26 50
downstream ENSMUSE00000612143 Chr12:83473355..83473529 ATCCTTTTAGCCGGACTCGT Chr12:83473499..83473518 60.1 50
downstream ENSMUSE00000479751 Chr12:83485638..83485741 ATGGTGGAGACGTGGAACAT Chr12:83485713..83485732 60.25 50
downstream ENSMUSE00000447752 Chr12:83488542..83488699 GATGTTTTTCGGGCTGAATG Chr12:83488631..83488650 60.45 45
downstream ENSMUSE00000447746 Chr12:83497180..83497753 CACCGCTAATGAAGCTCTCC Chr12:83497724..83497743 59.98 55
downstream ENSMUSE00000345516 Chr12:83498333..83498607 GGTTCTACATCCGCCACAAT Chr12:83498442..83498461 59.82 50
downstream ENSMUSE00000447731 Chr12:83503897..83504166 AGATGCTTCGAGGGATGTTG Chr12:83504141..83504160 60.22 50
downstream ENSMUSE00000447725 Chr12:83517891..83518037 TGGACGAAGACAAGTTGCTG Chr12:83517988..83518007 60.03 50
downstream ENSMUSE00000447718 Chr12:83521525..83521649 GTGGATTTTCCACTGCCACT Chr12:83521608..83521627 59.97 50
downstream ENSMUSE00000447711 Chr12:83523362..83523480 CCTTCGATACTGCTGGGAGA Chr12:83523397..83523416 60.35 55
downstream ENSMUSE00000447703 Chr12:83526000..83526442 CCCATCGTACCACTTCTCGT Chr12:83526092..83526111 59.99 55
downstream ENSMUSE00000447698 Chr12:83533740..83533979 TCCCACGGAGTTAATGGTTC Chr12:83533965..83533984 59.79 50
downstream ENSMUSE00000447692 Chr12:83534676..83534841 TGAGGCTCGAAGCCTAGTGT Chr12:83534730..83534749 60.16 55
downstream ENSMUSE00000447685 Chr12:83538675..83538921 GTGGAAGTGACTTGGGGAGA Chr12:83538882..83538901 60.09 55
downstream ENSMUSE00000358226 Chr12:83541802..83541948 GCGGCATCTACTAGGTTGGA Chr12:83541937..83541956 60.24 55
downstream ENSMUSE00000275863 Chr12:83547804..83547918 CTCCTCCAGCTGGTCACTGT Chr12:83547889..83547908 60.46 60
downstream ENSMUSE00000371292 Chr12:83550297..83550378 TTCTCGAAGCATTTTCAGCA Chr12:83550369..83550388 59.69 40
downstream ENSMUSE00000683518 Chr12:83550297..83550391 TTCTCGAAGCATTTTCAGCA Chr12:83550369..83550388 59.69 40
downstream ENSMUSE00000412789 Chr12:83550888..83551258 GCTGTGCACTGTCCGATATG Chr12:83551163..83551182 60.3 55
downstream ENSMUSE00000683517 Chr12:83550888..83552769 CCAGGGCAAGTGGTTTTCTA Chr12:83552253..83552272 60.1 50
downstream ENSMUSE00000683520 Chr12:83550888..83552769 CCAGGGCAAGTGGTTTTCTA Chr12:83552253..83552272 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCTGGCTTCTTTCCTTCC Chr12:83301067..83301087 60.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAGTAGTTGGCGTGACTGG Chr12:83301103..83301124 59.29 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042700