Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31080
Trapped Gene
Armetl1 (ENSMUSG00000039496)
Vector Insertion
Chr 2: 3430514 - 3436572
Public Clones IST14544G9 (tigm) IST12295G3 (tigm) IST13515E3 (tigm) IST11599G3 (tigm)
IST14413B2 (tigm) IST14446A3 (tigm) IST10767F2 (tigm) IST10555B5 (tigm)
IST10034D4 (tigm) IST10901F5 (tigm) IST12765B1 (tigm) IST10901F5 (tigm)
IST10731G5 (tigm) IST10314A10 (tigm) IST12875D3 (tigm) IST14144B7 (tigm)
IST13871F6 (tigm) IST10844D2 (tigm) IST14490A3 (tigm) IST14623E6 (tigm)
IST11502C5 (tigm) IST14790H12 (tigm) IST13934E4 (tigm) IST11552A9 (tigm)
IST10453B11 (tigm) IST14675F8 (tigm) IST13054C6 (tigm) IST10119D5 (tigm)
IST14490A3 (tigm) IST10684F10 (tigm) IST11049H10 (tigm) IST10852G4 (tigm)
IST11054C2 (tigm) IST10314A10 (tigm) IST10684H10 (tigm) IST15095B10 (tigm)
IST14375E2 (tigm) IST11502C5 (tigm) IST11049H10 (tigm) IST10827A2 (tigm)
IST10609D10 (tigm) IST12087B1 (tigm) IST14330D9 (tigm) IST13871F6 (tigm)
IST10286D5 (tigm) IST12058G2 (tigm) IST10851G5 (tigm) IST14843A4 (tigm)
IST10382C11 (tigm) IST14277E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000379882 (Chr2:3430335..3430513 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTCCAACTGCTCTGGTGA Chr2:3430410..3430429 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000379882 (Chr2:3430335..3430513 +)
Downstram Exon
ENSMUSE00000336940 (Chr2:3436573..3436700 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTCCAACTGCTCTGGTGA Chr2:3430410..3430429 60.02 55 ATGGTGTCCGCAGAAAAGTC Chr2:3436648..3436667 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379882 Chr2:3430335..3430513 CAGTCCAACTGCTCTGGTGA Chr2:3430410..3430429 60.02 55

*** Putative Vector Insertion (Chr 2: 3430514 - 3436572) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336940 Chr2:3436573..3436700 ATGGTGTCCGCAGAAAAGTC Chr2:3436648..3436667 60.12 50
downstream ENSMUSE00000319280 Chr2:3438288..3438429 TAGGATCTTGGTGGCTGCAT Chr2:3438335..3438354 60.62 50
downstream ENSMUSE00000405973 Chr2:3441083..3443648 AACTGTCCTCCTCCAGCTCA Chr2:3442215..3442234 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACAAATGTGGTCGAGGT Chr2:3430517..3430537 60.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACAAATGTGGTCGAGGT Chr2:3430517..3430537 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039496