Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31082
Trapped Gene
Ptpn6 (ENSMUSG00000004266)
Vector Insertion
Chr 6: 124670734 - 124671241
Public Clones IST14374C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000195615 (Chr6:124671098..124671240 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000195615 (Chr6:124671098..124671240 -)
Downstram Exon
ENSMUSE00000691829 (Chr6:124670735..124670926 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691840 Chr6:124683574..124683584 No primer for this exon
upstream ENSMUSE00000691827 Chr6:124682964..124683130 No primer for this exon
upstream ENSMUSE00000195617 Chr6:124682756..124682878 No primer for this exon
upstream ENSMUSE00000248262 Chr6:124682318..124682512 No primer for this exon
upstream ENSMUSE00000248256 Chr6:124678799..124678988 No primer for this exon
upstream ENSMUSE00000195634 Chr6:124678566..124678682 No primer for this exon
upstream ENSMUSE00000195632 Chr6:124678355..124678468 No primer for this exon
upstream ENSMUSE00000195642 Chr6:124678130..124678226 No primer for this exon
upstream ENSMUSE00000195630 Chr6:124677734..124677813 No primer for this exon
upstream ENSMUSE00000195626 Chr6:124677403..124677552 No primer for this exon
upstream ENSMUSE00000248221 Chr6:124675245..124675376 No primer for this exon
upstream ENSMUSE00000195622 Chr6:124674975..124675129 No primer for this exon
upstream ENSMUSE00000195628 Chr6:124672029..124672096 No primer for this exon
upstream ENSMUSE00000195621 Chr6:124671781..124671932 No primer for this exon
upstream ENSMUSE00000195625 Chr6:124671594..124671685 No primer for this exon
upstream ENSMUSE00000195615 Chr6:124671098..124671240 No primer for this exon
upstream ENSMUSE00000691829 Chr6:124670735..124670926 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGAACGTGACTGGGAAA Chr6:124671177..124671197 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004266