Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31083
Trapped Gene
Kcnc3 (ENSMUSG00000062785)
Vector Insertion
Chr 7: 51851639 - 51853753
Public Clones IST14054C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275186 (Chr7:51850531..51851638 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTTCTTGACCTACGTGGA Chr7:51850696..51850715 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275186 (Chr7:51850531..51851638 +)
Downstram Exon
ENSMUSE00000674788 (Chr7:51853754..51853945 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTTCTTGACCTACGTGGA Chr7:51850696..51850715 60.1 55 GGAGTGATTGGGCTCTTGTC Chr7:51853862..51853881 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674785 Chr7:51846034..51847128 GCACGGACGAGTTCTTCTTC Chr7:51846653..51846672 60 55
upstream ENSMUSE00000491194 Chr7:51846256..51847128 GCACGGACGAGTTCTTCTTC Chr7:51846653..51846672 60 55
upstream ENSMUSE00000275186 Chr7:51850531..51851638 CCCTTCTTGACCTACGTGGA Chr7:51850696..51850715 60.1 55

*** Putative Vector Insertion (Chr 7: 51851639 - 51853753) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000275182 Chr7:51853751..51853945 GGAGTGATTGGGCTCTTGTC Chr7:51853862..51853881 59.66 55
downstream ENSMUSE00000674788 Chr7:51853754..51853945 GGAGTGATTGGGCTCTTGTC Chr7:51853862..51853881 59.66 55
downstream ENSMUSE00000674784 Chr7:51856239..51856298 GTCTCAGGCGGTGACAAGAG Chr7:51856261..51856280 61.01 60
downstream ENSMUSE00000513173 Chr7:51857239..51857511 CCCTACTCCCAGCTCCTTTT Chr7:51857443..51857462 59.71 55
downstream ENSMUSE00000674786 Chr7:51857239..51860124 GAAGGGGCATGACACTGTTT Chr7:51860075..51860094 59.97 50
downstream ENSMUSE00000674787 Chr7:51857239..51857462 CCCTACTCCCAGCTCCTTTT Chr7:51857443..51857462 59.71 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000062785