Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31094
Trapped Gene
Slc4a4 (ENSMUSG00000060961)
Vector Insertion
Chr 5: 89628842 - 89643498
Public Clones (sanger) IST12137D3 (tigm) IST11036B7 (tigm) IST11012C7 (tigm) IST12075D8 (tigm)
IST10607A4 (tigm) IST12681C7 (tigm) IST12034F3 (tigm) IST10120F8 (tigm)
IST12157C12 (tigm) IST11443B2 (tigm) IST12469G2 (tigm) IST12667C9 (tigm)
IST11012C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222154 (Chr5:89628680..89628841 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAACAGGGGTTGGTTTGTCC Chr5:89628691..89628710 59.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222154 (Chr5:89628680..89628841 +)
Downstram Exon
ENSMUSE00000188236 (Chr5:89643499..89643677 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAACAGGGGTTGGTTTGTCC Chr5:89628691..89628710 59.69 50 GACTGTCAATGTGGGCAATG Chr5:89643622..89643641 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694812 Chr5:89316322..89316349 No primer for this exon
upstream ENSMUSE00000486552 Chr5:89363774..89363847 GGGGCTTCCTTCCTTAAACA Chr5:89363802..89363821 60.42 50
upstream ENSMUSE00000222258 Chr5:89383803..89383982 ACGATCTACATTGGGGTCCA Chr5:89383811..89383830 60.19 50
upstream ENSMUSE00000423258 Chr5:89457102..89457453 GAACGCATCCGATTCATCTT Chr5:89457332..89457351 60.04 45
upstream ENSMUSE00000513687 Chr5:89457318..89457453 GAACGCATCCGATTCATCTT Chr5:89457332..89457351 60.04 45
upstream ENSMUSE00000510764 Chr5:89467476..89467636 ACAGCCTGTTTGAGCTGAGG Chr5:89467553..89467572 60.59 55
upstream ENSMUSE00000694806 Chr5:89469383..89471385 CACACACACACACACCCTGA Chr5:89471156..89471175 60.09 55
upstream ENSMUSE00000515446 Chr5:89475238..89475417 CCAGATCGAGACAGGCCTAC Chr5:89475254..89475273 59.83 60
upstream ENSMUSE00000512636 Chr5:89513667..89513743 CCCACAGGAATCTGACATCC Chr5:89513682..89513701 60.33 55
upstream ENSMUSE00000517188 Chr5:89551427..89551584 CATTGCCTTTGTTCGCCTAC Chr5:89551516..89551535 60.64 50
upstream ENSMUSE00000188238 Chr5:89558664..89558751 AAGAGCTATCGCCACCTTGA Chr5:89558721..89558740 59.98 50
upstream ENSMUSE00000188244 Chr5:89561396..89561550 GACCCCACAATCCGAATAGA Chr5:89561498..89561517 59.75 50
upstream ENSMUSE00000188249 Chr5:89562182..89562295 GATGAATGGGGACACACCTC Chr5:89562215..89562234 60.18 55
upstream ENSMUSE00000188241 Chr5:89564671..89564845 ATCTGGCAACCGTAACCAAC Chr5:89564778..89564797 59.86 50
upstream ENSMUSE00000188239 Chr5:89578325..89578458 GGACCAGTGTTGGTGTTTGA Chr5:89578415..89578434 59.42 50
upstream ENSMUSE00000188245 Chr5:89585356..89585627 TCACCCGTTTCACAGAAGAA Chr5:89585463..89585482 59.26 45
upstream ENSMUSE00000188255 Chr5:89599776..89599846 CCTGCCGACCATTTCTTCTA Chr5:89599819..89599838 60.21 50
upstream ENSMUSE00000188259 Chr5:89608678..89608869 TCTTCCTGGGCACTTACACC Chr5:89608799..89608818 60.11 55
upstream ENSMUSE00000222161 Chr5:89626674..89626787 GTGGACACTCCGAAGCTCAT Chr5:89626749..89626768 60.27 55
upstream ENSMUSE00000222154 Chr5:89628680..89628841 TAACAGGGGTTGGTTTGTCC Chr5:89628691..89628710 59.69 50

*** Putative Vector Insertion (Chr 5: 89628842 - 89643498) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188236 Chr5:89643499..89643677 GACTGTCAATGTGGGCAATG Chr5:89643622..89643641 59.97 50
downstream ENSMUSE00000188257 Chr5:89644746..89644818 GGGTTCCAGTGACTCGTTGT Chr5:89644771..89644790 60.01 55
downstream ENSMUSE00000496324 Chr5:89652221..89652289 CTGCACACCGTTAAGTGAGG Chr5:89652292..89652311 59.36 55
downstream ENSMUSE00000497078 Chr5:89654825..89654998 GGTAGATGAAGTCGGGCTGA Chr5:89654888..89654907 60.22 55
downstream ENSMUSE00000498161 Chr5:89657851..89658012 TCGTCATTGTCGCTATCCAA Chr5:89658014..89658033 60.22 45
downstream ENSMUSE00000498979 Chr5:89661789..89661885 AGGTTGCTGTTCCATGATGTC Chr5:89661859..89661879 59.99 47.62
downstream ENSMUSE00000499989 Chr5:89663822..89663901 GGTAAACCCAGCGACTCAAG Chr5:89663901..89663920 59.73 55
downstream ENSMUSE00000694811 Chr5:89663822..89663892 CGTTCGAGGAATGTTGAGGA Chr5:89663852..89663871 61.18 50
downstream ENSMUSE00000694814 Chr5:89664532..89664563 AGGCACGACTTTCACTGGAG Chr5:89664565..89664584 60.44 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:89634892..89634912 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACAAAACCAGGAGGAGCAC Chr5:89634873..89634894 61.04 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060961