Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3110
Trapped Gene
Myo1e (ENSMUSG00000032220)
Vector Insertion
Chr 9: 70055511 - 70134718
Public Clones CH0703 (sanger) (sanger) AN0665 (sanger) (sanger) RRR793 (baygenomics)
XK022 (baygenomics) 5SE187E03 (ggtc) (ggtc) 3SE288F09 (ggtc) (ggtc)
3SE187E03 (ggtc) 5SD094C12 (ggtc) 5SE223C10 (ggtc) (ggtc)
5SE288F09 (ggtc) FHCRC-GT-S1-7G1 (fhcrc) Ayu21-KBW120 (egtc) IST12261E6 (tigm)
IST11907C5 (tigm) IST14813D4 (tigm) IST14781D3 (tigm)
Private Clones OST356184 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696349 (Chr9:70055157..70055510 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGCCTTCACCTAGCGTTT Chr9:70055307..70055326 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696349 (Chr9:70055157..70055510 +)
Downstram Exon
ENSMUSE00000409917 (Chr9:70134719..70134862 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGCCTTCACCTAGCGTTT Chr9:70055307..70055326 59.88 45 CATGTCGTCCACACCACTGT Chr9:70134790..70134809 60.5 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696349 Chr9:70055157..70055510 TTTGCCTTCACCTAGCGTTT Chr9:70055307..70055326 59.88 45

*** Putative Vector Insertion (Chr 9: 70055511 - 70134718) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409917 Chr9:70134719..70134862 CATGTCGTCCACACCACTGT Chr9:70134790..70134809 60.5 55
downstream ENSMUSE00000321162 Chr9:70145074..70145163 TTGCTTGAATGGGTTGACAG Chr9:70145121..70145140 59.69 45
downstream ENSMUSE00000532198 Chr9:70149500..70149594 AGGCGGGTTCTCATACTGTG Chr9:70149523..70149542 60.13 55
downstream ENSMUSE00000418346 Chr9:70164399..70164486 ACTTGGCAGCCACTGTCTTT Chr9:70164439..70164458 59.91 50
downstream ENSMUSE00000532197 Chr9:70167876..70167965 GAGTTGTTGTTGCGCACTGT Chr9:70167958..70167977 59.95 50
downstream ENSMUSE00000532196 Chr9:70170199..70170330 CCACCTGGACTGAACTGGAT Chr9:70170236..70170255 59.96 55
downstream ENSMUSE00000217869 Chr9:70172640..70172774 ATCCCGCTTGTCATCAATGT Chr9:70172762..70172781 60.35 45
downstream ENSMUSE00000217856 Chr9:70174951..70175083 TGCTCTTCCGAGAAGATTCC Chr9:70174991..70175010 59.51 50
downstream ENSMUSE00000320764 Chr9:70182922..70183118 GATACGCAGGAAAAGCCAAA Chr9:70182945..70182964 60.21 45
downstream ENSMUSE00000321040 Chr9:70185536..70185616 TGTTGTACTCCTCGTGGTCCT Chr9:70185580..70185600 59.63 52.38
downstream ENSMUSE00000532195 Chr9:70186524..70186610 GCTCTGCTTTTAGCGTCAGC Chr9:70186611..70186630 60.44 55
downstream ENSMUSE00000217876 Chr9:70189088..70189174 TGTCCATCTTATTCCCTCCTG Chr9:70189122..70189142 58.99 47.62
downstream ENSMUSE00000217868 Chr9:70189789..70189956 TGGTTCCAGCTGTTGAAGTG Chr9:70189928..70189947 59.87 50
downstream ENSMUSE00000217867 Chr9:70190851..70190936 CAGAAGCCGTCCATGTCATA Chr9:70190879..70190898 59.67 50
downstream ENSMUSE00000217872 Chr9:70194494..70194575 TTGTCAGCTTGCAGGTTTTC Chr9:70194541..70194560 59.05 45
downstream ENSMUSE00000532193 Chr9:70201067..70201173 TTGGTTTTATGCAGCGAATG Chr9:70201139..70201158 59.7 40
downstream ENSMUSE00000320687 Chr9:70207092..70207190 ACACGCCGATAAGCATAACC Chr9:70207172..70207191 59.99 50
downstream ENSMUSE00000320661 Chr9:70210030..70210174 CACACAGGCCAGGTAGCTTT Chr9:70210068..70210087 60.31 55
downstream ENSMUSE00000418260 Chr9:70215423..70215537 ACACGTGCGTAACCATCGTA Chr9:70215478..70215497 60.06 50
downstream ENSMUSE00000532191 Chr9:70216476..70216645 TAGTCCCCGATGAAGTTTCG Chr9:70216548..70216567 60.07 50
downstream ENSMUSE00000217874 Chr9:70218164..70218309 ATCCTTTCCACCTCGATCCT Chr9:70218294..70218313 59.9 50
downstream ENSMUSE00000217844 Chr9:70224311..70224457 TTTCCTCGTATCGCTTTGCT Chr9:70224423..70224442 59.98 45
downstream ENSMUSE00000217882 Chr9:70226018..70226175 GCTTGAGGATAGCCAGGTCA Chr9:70226124..70226143 60.36 55
downstream ENSMUSE00000351744 Chr9:70226528..70226617 TTCCACCTGGATACCCTCTG Chr9:70226578..70226597 59.92 55
downstream ENSMUSE00000318927 Chr9:70231611..70231812 GATTGGACCTCTGGTTTCCA Chr9:70231688..70231707 59.9 50
downstream ENSMUSE00000339105 Chr9:70243583..70243752 AATATCGTTGGCGTTGAAGC Chr9:70243736..70243755 60.1 45
downstream ENSMUSE00000635733 Chr9:70246529..70247874 AGCAGTCCCCGCTACTTACA Chr9:70246901..70246920 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTTCTTCCTGCAGTAATCG Chr9:70100547..70100568 59.46 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr9:70100558..70100578 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032220