Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31102
Trapped Gene
Plcd1 (ENSMUSG00000010660)
Vector Insertion
Chr 9: 118993707 - 119002621
Public Clones IST14963D8 (tigm) IST14854D3 (tigm) IST14395A1 (tigm) IST13828D10 (tigm)
IST14717F3 (tigm) IST14717F3 (tigm) IST10524C12 (tigm) IST14854D2 (tigm)
IST14854D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000356709 (Chr9:119002476..119002620 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000356709 (Chr9:119002476..119002620 -)
Downstram Exon
ENSMUSE00000270426 (Chr9:118993708..118993872 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000356709 Chr9:119002476..119002620 No primer for this exon
upstream ENSMUSE00000270426 Chr9:118993708..118993872 No primer for this exon

*** Putative Vector Insertion (Chr 9: 118993707 - 119002621) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000270408 Chr9:118990040..118990268 No primer for this exon
downstream ENSMUSE00000270389 Chr9:118985202..118985331 No primer for this exon
downstream ENSMUSE00000134404 Chr9:118984882..118985113 No primer for this exon
downstream ENSMUSE00000134401 Chr9:118983991..118984192 No primer for this exon
downstream ENSMUSE00000134398 Chr9:118983754..118983898 No primer for this exon
downstream ENSMUSE00000134400 Chr9:118983528..118983677 No primer for this exon
downstream ENSMUSE00000134407 Chr9:118983283..118983441 No primer for this exon
downstream ENSMUSE00000134403 Chr9:118982881..118983040 No primer for this exon
downstream ENSMUSE00000134397 Chr9:118982574..118982690 No primer for this exon
downstream ENSMUSE00000134406 Chr9:118981593..118981771 No primer for this exon
downstream ENSMUSE00000134405 Chr9:118981368..118981500 No primer for this exon
downstream ENSMUSE00000134399 Chr9:118981141..118981290 No primer for this exon
downstream ENSMUSE00000352230 Chr9:118980648..118981005 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCATGTTTCACTGCTCT Chr9:118999576..118999596 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGCATGTTTCACTGCTCT Chr9:118999576..118999596 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010660