Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31105
Trapped Gene
Serpinb9e (ENSMUSG00000062342)
Vector Insertion
Chr 13: 33341542 - 33343444
Public Clones IST14391H2 (tigm) IST12291G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000494223 (Chr13:33341477..33341541 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCACCGTGAGATCAGAAA Chr13:33341514..33341533 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000494223 (Chr13:33341477..33341541 +)
Downstram Exon
ENSMUSE00000492177 (Chr13:33343445..33343622 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCACCGTGAGATCAGAAA Chr13:33341514..33341533 59.98 50 ACCATGGCTAGAGCAGAGGA Chr13:33343582..33343601 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000494223 Chr13:33341477..33341541 CTGCACCGTGAGATCAGAAA Chr13:33341514..33341533 59.98 50

*** Putative Vector Insertion (Chr 13: 33341542 - 33343444) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000492177 Chr13:33343445..33343622 ACCATGGCTAGAGCAGAGGA Chr13:33343582..33343601 59.97 55
downstream ENSMUSE00000571306 Chr13:33344736..33344876 GGTTGTTTGGCTTGTTCAGG Chr13:33344817..33344836 60.53 50
downstream ENSMUSE00000571305 Chr13:33345314..33345431 ATGTGTTGCCTGGACTCCTC Chr13:33345405..33345424 60.12 55
downstream ENSMUSE00000501624 Chr13:33346889..33347031 GCGAGAATTAGCCTGGTCTG Chr13:33346952..33346971 59.98 55
downstream ENSMUSE00000482816 Chr13:33349526..33349681 CTGGGAGTAGGACCACGAAA Chr13:33349661..33349680 60.1 55
downstream ENSMUSE00000481015 Chr13:33351594..33352713 AGCAGTCCTCACCCAGAGAA Chr13:33352415..33352434 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGACAATGGGACACCAAAA Chr13:33341565..33341585 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGACAATGGGACACCAAAA Chr13:33341565..33341585 60.21 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062342