Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31115
Trapped Gene
Garnl4 (ENSMUSG00000038807)
Vector Insertion
Chr 11: 74298388 - 74380754
Public Clones IST12501D7 (tigm) IST14830F9 (tigm) IST11327E10 (tigm) IST14782H7 (tigm)
IST12499D7 (tigm) IST14738G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708056 (Chr11:74380718..74380753 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708056 (Chr11:74380718..74380753 -)
Downstram Exon
ENSMUSE00000578470 (Chr11:74298389..74298473 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGTGAGAGGAGGGGACAGT Chr11:74298384..74298403 59.27 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676835 Chr11:74403462..74403583 GTCCTGATGGAGAGCTGTGG Chr11:74403544..74403563 60.83 60
upstream ENSMUSE00000676853 Chr11:74403462..74403660 GTCCTGATGGAGAGCTGTGG Chr11:74403544..74403563 60.83 60
upstream ENSMUSE00000661819 Chr11:74403461..74403688 GTCCTGATGGAGAGCTGTGG Chr11:74403544..74403563 60.83 60
upstream ENSMUSE00000661818 Chr11:74380718..74380753 No primer for this exon
upstream ENSMUSE00000708056 Chr11:74380718..74380753 No primer for this exon
upstream ENSMUSE00000578470 Chr11:74298389..74298473 CACTGTCCCCTCCTCTCACT Chr11:74298407..74298426 59.27 60

*** Putative Vector Insertion (Chr 11: 74298388 - 74380754) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676836 Chr11:74255922..74255933 No primer for this exon
downstream ENSMUSE00000578469 Chr11:74255252..74255287 CCAGCATCTCGAAGAACTCC Chr11:74255241..74255260 59.95 55
downstream ENSMUSE00000578468 Chr11:74251766..74251810 CTTGTTCTTCTGGGGTCCTG Chr11:74251744..74251763 59.69 55
downstream ENSMUSE00000578467 Chr11:74250933..74250965 TGCTGGGGTACGGGATATAG Chr11:74250919..74250938 59.8 55
downstream ENSMUSE00000578466 Chr11:74250426..74250638 CGTTGGAGTACCCACGTTCT Chr11:74250524..74250543 60.03 55
downstream ENSMUSE00000650866 Chr11:74250425..74250638 CGTTGGAGTACCCACGTTCT Chr11:74250524..74250543 60.03 55
downstream ENSMUSE00000578465 Chr11:74249203..74249306 GATCCGAAGGTACTCCATGC Chr11:74249189..74249208 59.51 55
downstream ENSMUSE00000578464 Chr11:74239414..74239492 AGCCAAGGGGATTCTCTCAT Chr11:74239431..74239450 60.04 50
downstream ENSMUSE00000578463 Chr11:74238684..74238737 GGGGTACAAAACAGGGTTGA Chr11:74238665..74238684 59.69 50
downstream ENSMUSE00000578462 Chr11:74235932..74236015 TGCCTGGCTTTTTGATAAATG Chr11:74235911..74235931 60.08 38.1
downstream ENSMUSE00000578461 Chr11:74229734..74229834 AATCCTGCAGTGTGATGGTG Chr11:74229719..74229738 59.55 50
downstream ENSMUSE00000578460 Chr11:74227893..74228022 GGGTGTCACCATCCGTAAAG Chr11:74227876..74227895 60.23 55
downstream ENSMUSE00000578459 Chr11:74225799..74225954 GCCACGATATCATTCCCAAT Chr11:74225895..74225914 59.61 45
downstream ENSMUSE00000302623 Chr11:74221390..74221461 AGGCACATCTTCCCTAGCAG Chr11:74221410..74221429 59.45 55
downstream ENSMUSE00000302610 Chr11:74220813..74220899 AGCAAGCATTCTCTGCGTTC Chr11:74220820..74220839 60.69 50
downstream ENSMUSE00000302600 Chr11:74219225..74219359 GAAGGTTGTCCAGGAGAGCA Chr11:74219304..74219323 60.39 55
downstream ENSMUSE00000302591 Chr11:74210859..74210996 GTGACCTCCATGCTGTTGTG Chr11:74210853..74210872 60.16 55
downstream ENSMUSE00000302580 Chr11:74209281..74209399 No primer for this exon
downstream ENSMUSE00000302570 Chr11:74206871..74206984 GAGAGCTGGGATTTGACGAG Chr11:74206874..74206893 59.95 55
downstream ENSMUSE00000302562 Chr11:74206547..74206664 CCACTGTCACACTCCTCCAT Chr11:74206526..74206545 58.51 55
downstream ENSMUSE00000302553 Chr11:74205722..74205848 GCTGTAGGCAAACACCTCCT Chr11:74205773..74205792 59.36 55
downstream ENSMUSE00000661817 Chr11:74202285..74202361 CTCGGGGAGTTTCTGCTTTT Chr11:74202315..74202334 60.73 50
downstream ENSMUSE00000661816 Chr11:74201821..74201859 GGGAAGGTCTTCACTTTCACA Chr11:74201808..74201828 59.17 47.62
downstream ENSMUSE00000676837 Chr11:74196985..74201013 CAAAGAGACACGGGATTGGT Chr11:74197499..74197518 59.97 50
downstream ENSMUSE00000661815 Chr11:74196858..74201013 CAAAGAGACACGGGATTGGT Chr11:74197499..74197518 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCGGTAAAAACGCAAGCTG Chr11:74359762..74359782 60.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCGGTAAAAACGCAAGCTG Chr11:74359762..74359782 60.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038807