Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31120
Trapped Gene
Acsbg2 (ENSMUSG00000024207)
Vector Insertion
Chr 17: 56989457 - 56993337
Public Clones IST12500F1 (tigm) IST12332E3 (tigm) IST11447E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139734 (Chr17:56993160..56993336 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACATCTGGATCCCCATCA Chr17:56993204..56993223 60.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139734 (Chr17:56993160..56993336 -)
Downstram Exon
ENSMUSE00000139739 (Chr17:56989458..56989639 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACATCTGGATCCCCATCA Chr17:56993204..56993223 60.29 50 TTGAAGCGTGTACACCAAGG Chr17:56989594..56989613 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606654 Chr17:57013620..57013870 CTGGCCACCTTGTGAAAGTT Chr17:57013621..57013640 60.15 50
upstream ENSMUSE00000606653 Chr17:57012220..57012320 GAGAAGAAGGCGGAAGACCT Chr17:57012246..57012265 59.96 55
upstream ENSMUSE00000606652 Chr17:57007649..57007878 CCTCAAAGAACGGCAAAAAG Chr17:57007715..57007734 59.85 45
upstream ENSMUSE00000606651 Chr17:57003883..57003971 GGTCGAGTGGGTCGTTACTG Chr17:57003905..57003924 60.57 60
upstream ENSMUSE00000606650 Chr17:57002294..57002414 GCAGGCCAACGTGAGTATCT Chr17:57002335..57002354 60.28 55
upstream ENSMUSE00000693748 Chr17:57002290..57002414 GCAGGCCAACGTGAGTATCT Chr17:57002335..57002354 60.28 55
upstream ENSMUSE00000693747 Chr17:57002084..57002091 No primer for this exon
upstream ENSMUSE00000606649 Chr17:57000962..57001045 GAGACCGTGAAAGCCATTGT Chr17:57001008..57001027 60.12 50
upstream ENSMUSE00000693746 Chr17:57000962..57001030 GAGACCGTGAAAGCCATTGT Chr17:57001008..57001027 60.12 50
upstream ENSMUSE00000463791 Chr17:56996302..56996451 CCAACCAGTGTGCTGTCATC Chr17:56996359..56996378 60.16 55
upstream ENSMUSE00000139734 Chr17:56993160..56993336 AGACATCTGGATCCCCATCA Chr17:56993204..56993223 60.29 50
upstream ENSMUSE00000139739 Chr17:56989458..56989639 CCTTGGTGTACACGCTTCAA Chr17:56989616..56989635 59.76 50

*** Putative Vector Insertion (Chr 17: 56989457 - 56993337) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139742 Chr17:56989138..56989371 CGGTAATTCATGGGGATGTC Chr17:56989323..56989342 60.01 50
downstream ENSMUSE00000139735 Chr17:56987034..56987251 GCGGCCAGTGATATAAAGGA Chr17:56987019..56987038 60.06 50
downstream ENSMUSE00000139740 Chr17:56985945..56986084 CACCAGCGGTTATCAGGATT Chr17:56986042..56986061 59.96 50
downstream ENSMUSE00000139736 Chr17:56985516..56985762 GATGGCCGTGTAGACCACTT Chr17:56985600..56985619 60 55
downstream ENSMUSE00000139733 Chr17:56984827..56984936 No primer for this exon
downstream ENSMUSE00000606648 Chr17:56982527..56982800 AGGAAGGTGTTTTGGGCTCT Chr17:56982548..56982567 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCGAGTAATCGCCTTGC Chr17:56993274..56993294 61.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGATAAACCGAGCGTGAC Chr17:56993280..56993300 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024207