Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31125
Trapped Gene
Ankrd35 (ENSMUSG00000038354)
Vector Insertion
Chr 3: 96486955 - 96487105
Public Clones IST12409F10 (tigm) IST12963H5 (tigm) IST10934F1 (tigm) IST13074C6 (tigm)
IST10283F6 (tigm) IST10236H1 (tigm) IST10386H10 (tigm) IST10934G1 (tigm)
IST12024A10 (tigm) IST10386H10 (tigm) IST12860H11 (tigm) IST12024A10 (tigm)
IST13606G7 (tigm) IST10236H1 (tigm) IST10934F1 (tigm) IST12455B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362130 (Chr3:96486917..96486954 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACCCAGATCACCCATCTC Chr3:96486933..96486952 59.77 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362130 (Chr3:96486917..96486954 +)
Downstram Exon
ENSMUSE00000354995 (Chr3:96487106..96489097 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACCCAGATCACCCATCTC Chr3:96486933..96486952 59.77 55 CCGATGAGGTGGTTTGTCTT Chr3:96489075..96489094 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410288 Chr3:96474054..96474372 TAGCCGAGTTGGGTTAGGAA Chr3:96474260..96474279 59.7 50
upstream ENSMUSE00000370295 Chr3:96482056..96482186 AGAAATGGAACCGACGTGAT Chr3:96482060..96482079 59.41 45
upstream ENSMUSE00000397790 Chr3:96483103..96483191 CTCCAAAGGCCTGACAGAGT Chr3:96483118..96483137 59.45 55
upstream ENSMUSE00000357628 Chr3:96483553..96483617 CTTCATTTGGCCACCATCTC Chr3:96483564..96483583 60.46 50
upstream ENSMUSE00000346384 Chr3:96484394..96484451 GCAGAAAATCGCAGTCCATT Chr3:96484421..96484440 60.22 45
upstream ENSMUSE00000384381 Chr3:96484550..96484620 TCCTGGACGTGCTGGATAAT Chr3:96484601..96484620 60.48 50
upstream ENSMUSE00000334317 Chr3:96484885..96484991 TGCCCGAGTTAATGTCACAG Chr3:96484959..96484978 59.72 50
upstream ENSMUSE00000369013 Chr3:96485950..96486134 GTTTGGGACACAACGCTCTT Chr3:96486039..96486058 60.16 50
upstream ENSMUSE00000362130 Chr3:96486917..96486954 ACACCCAGATCACCCATCTC Chr3:96486933..96486952 59.77 55

*** Putative Vector Insertion (Chr 3: 96486955 - 96487105) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000354995 Chr3:96487106..96489097 CCGATGAGGTGGTTTGTCTT Chr3:96489075..96489094 59.97 50
downstream ENSMUSE00000248243 Chr3:96493069..96493158 GCTCGAGCTTCTTCAGCAAC Chr3:96493099..96493118 60.43 55
downstream ENSMUSE00000248237 Chr3:96493368..96493433 TTCGTGGTTCTTCTGGGAGT Chr3:96493391..96493410 59.7 50
downstream ENSMUSE00000438379 Chr3:96494115..96494957 TCAGGTCTGGAGTTCGTGTG Chr3:96494872..96494891 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGATCACCCATCTCAGGT Chr3:96486938..96486958 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGATCACCCATCTCAGGT Chr3:96486938..96486958 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038354