Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31127
Trapped Gene
Zfp13 (ENSMUSG00000062012)
Vector Insertion
Chr 17: 23712818 - 23717200
Public Clones IST12836A10 (tigm) IST14936D5 (tigm) IST10689G9 (tigm) IST13544H3 (tigm)
IST10266B2 (tigm) IST14767H11 (tigm) IST12238B2 (tigm) IST13761H9 (tigm)
IST10902H4 (tigm) IST13034A3 (tigm) IST14577H5 (tigm) IST12238B2 (tigm)
IST11631D8 (tigm) IST15054F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000335258 (Chr17:23717079..23717199 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCTCCCAGGAGGAGTGG Chr17:23717149..23717168 60.6 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000335258 (Chr17:23717079..23717199 -)
Downstram Exon
ENSMUSE00000496162 (Chr17:23712819..23714078 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCTCCCAGGAGGAGTGG Chr17:23717149..23717168 60.6 60 TCATCCCACTGGCTAAGACC Chr17:23712904..23712923 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347574 Chr17:23736119..23736454 ATGGCAGAGCACCTCAACTT Chr17:23736186..23736205 59.87 50
upstream ENSMUSE00000383128 Chr17:23722405..23722541 CGGCTACTGAGAACGAGGAG Chr17:23722417..23722436 60.15 60
upstream ENSMUSE00000612751 Chr17:23718045..23718237 AGCCAGAAGAGCCACACAGT Chr17:23718121..23718140 60.06 55
upstream ENSMUSE00000703191 Chr17:23718024..23718237 AGCCAGAAGAGCCACACAGT Chr17:23718121..23718140 60.06 55
upstream ENSMUSE00000379212 Chr17:23717738..23717829 GGACCAGAGAGCGAAAGATG Chr17:23717768..23717787 59.95 55
upstream ENSMUSE00000335258 Chr17:23717079..23717199 ATCTCTCCCAGGAGGAGTGG Chr17:23717149..23717168 60.6 60
upstream ENSMUSE00000496162 Chr17:23712819..23714078 GGTCTTAGCCAGTGGGATGA Chr17:23712926..23712945 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCAGCAAACCCTGAATAG Chr17:23714220..23714240 58.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCAGCAAACCCTGAATAG Chr17:23714220..23714240 58.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062012