Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3116
Trapped Gene
Vbp1 (ENSMUSG00000031197)
Vector Insertion
Chr X: 72768698 - 72769174
Public Clones CH0545 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207191 (ChrX:72768599..72768697 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCCGATAACCTGTACTGC ChrX:72768633..72768652 61.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207191 (ChrX:72768599..72768697 +)
Downstram Exon
ENSMUSE00000698022 (ChrX:72769175..72769186 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCCGATAACCTGTACTGC ChrX:72768633..72768652 61.05 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000207192 ChrX:72759667..72759767 AGAAACTGCTGCTGGAAACG ChrX:72759707..72759726 60.57 50
upstream ENSMUSE00000207190 ChrX:72762428..72762552 TGGAACTCAACCTTGCTCAG ChrX:72762522..72762541 59.01 50
upstream ENSMUSE00000207189 ChrX:72766702..72766768 No primer for this exon
upstream ENSMUSE00000207191 ChrX:72768599..72768697 TGGCCGATAACCTGTACTGC ChrX:72768633..72768652 61.05 55

*** Putative Vector Insertion (Chr X: 72768698 - 72769174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698022 ChrX:72769175..72769186 No primer for this exon
downstream ENSMUSE00000207193 ChrX:72776424..72776562 CAACAAGGCCTGAGCTTCAT ChrX:72776474..72776493 60.4 50
downstream ENSMUSE00000207188 ChrX:72779247..72780274 TCTTCCTGTTCGAGGTGCTT ChrX:72780039..72780058 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTTTTCTAATCGCCTTGC ChrX:72768740..72768761 59.75 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTATGGTTGGGGGTAAGT ChrX:72768685..72768705 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031197