Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31160
Trapped Gene
AC164532.4-202 (ENSMUSG00000074243)
Vector Insertion
Chr 7: 28549287 - 28734836
Public Clones (sanger) (sanger) (sanger) IST12369B4 (tigm) IST13271C4 (tigm)
IST14313A9 (tigm) IST13270C5 (tigm) IST13943B8 (tigm) IST15093G7 (tigm)
IST15061F6 (tigm) IST10022B9 (tigm) IST14374D5 (tigm) IST13270C5 (tigm)
IST10806B2 (tigm) IST10600F7 (tigm) IST13401A11 (tigm) IST15061D4 (tigm)
IST12369B4 (tigm) IST10875G9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636128 (Chr7:28733958..28734835 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGCATCTCATTGGGTTT Chr7:28734082..28734101 59.93 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636128 (Chr7:28733958..28734835 -)
Downstram Exon
ENSMUSE00000676344 (Chr7:28549288..28549305 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGCATCTCATTGGGTTT Chr7:28734082..28734101 59.93 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636128 Chr7:28733958..28734835 CCAAGCATCTCATTGGGTTT Chr7:28734082..28734101 59.93 45
upstream ENSMUSE00000676344 Chr7:28549288..28549305 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGGGAGAGGGAGTTATCAG Chr7:28644842..28644863 59.41 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGGGAGAGGGAGTTATCAG Chr7:28644842..28644863 59.41 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074243