Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31165
Trapped Gene
Pcca (ENSMUSG00000041650)
Vector Insertion
Chr 14: 123189677 - 123212415
Public Clones IST11831A7 (tigm) IST13099A10 (tigm) IST13814B5 (tigm) IST14473E4 (tigm)
IST14138F5 (tigm) IST10441B8 (tigm) IST13729B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225003 (Chr14:123189578..123189676 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAGTTGATGGCTCGAAAC Chr14:123189580..123189599 59.68 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225003 (Chr14:123189578..123189676 +)
Downstram Exon
ENSMUSE00000224995 (Chr14:123212416..123212469 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAGTTGATGGCTCGAAAC Chr14:123189580..123189599 59.68 50 GTGCCAAGAAACTGGATGCT Chr14:123212468..123212487 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361975 Chr14:122933561..122933681 No primer for this exon
upstream ENSMUSE00000225127 Chr14:122956937..122957014 TGCCTAGTGGTGTCCAGAAG Chr14:122956961..122956980 58.88 55
upstream ENSMUSE00000225122 Chr14:122962001..122962048 No primer for this exon
upstream ENSMUSE00000225114 Chr14:122962141..122962209 No primer for this exon
upstream ENSMUSE00000225109 Chr14:122981839..122981952 CCAGCTCCCACCAGTAAAAG Chr14:122981878..122981897 59.73 55
upstream ENSMUSE00000225101 Chr14:122984279..122984332 CCAGGGTATGGATTCCTGTC Chr14:122984285..122984304 59.21 55
upstream ENSMUSE00000225095 Chr14:123015976..123016107 AGGTCAACACAATCCCTGGT Chr14:123016070..123016089 59.28 50
upstream ENSMUSE00000225087 Chr14:123037603..123037639 TGTCAGAATTGCAAGGGAAA Chr14:123037617..123037636 59.25 40
upstream ENSMUSE00000225080 Chr14:123049474..123049552 TGTGATGATCAAGGCCTCAG Chr14:123049481..123049500 59.79 50
upstream ENSMUSE00000225074 Chr14:123057900..123058002 ATTTTCATCCCAGGAAGCTG Chr14:123057912..123057931 59.13 45
upstream ENSMUSE00000225070 Chr14:123063476..123063570 AGTGCTCGATCCAGAGAAGG Chr14:123063522..123063541 59.56 55
upstream ENSMUSE00000225065 Chr14:123067743..123067893 CTTTGGCTAAAGCCGTGAAG Chr14:123067793..123067812 60.01 50
upstream ENSMUSE00000225060 Chr14:123084104..123084247 TGAATGTCGGGTTTATGCTG Chr14:123084226..123084245 59.54 45
upstream ENSMUSE00000225052 Chr14:123085325..123085399 CCCAGTACCAAGAGCCGATA Chr14:123085368..123085387 60.09 55
upstream ENSMUSE00000225042 Chr14:123089321..123089389 GAGTTGACAGTGGCATCCAA Chr14:123089325..123089344 59.68 50
upstream ENSMUSE00000225033 Chr14:123091402..123091477 CCTGAAGAGGATGGAAGACG Chr14:123091434..123091453 59.8 55
upstream ENSMUSE00000225026 Chr14:123100277..123100387 CACACAACATCCCATTGCTC Chr14:123100283..123100302 59.97 50
upstream ENSMUSE00000225018 Chr14:123113245..123113347 CTCAGCGCTTCCAAGAACAT Chr14:123113323..123113342 60.54 50
upstream ENSMUSE00000225011 Chr14:123137124..123137226 TGGGAGCTCTCGGTAAAGTT Chr14:123137155..123137174 58.93 50
upstream ENSMUSE00000225003 Chr14:123189578..123189676 GGAAGTTGATGGCTCGAAAC Chr14:123189580..123189599 59.68 50

*** Putative Vector Insertion (Chr 14: 123189677 - 123212415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224995 Chr14:123212416..123212469 GTGCCAAGAAACTGGATGCT Chr14:123212468..123212487 60.26 50
downstream ENSMUSE00000224991 Chr14:123275986..123276126 TGCAGCAAGCTTGGTTAAAA Chr14:123276021..123276040 59.62 40
downstream ENSMUSE00000224986 Chr14:123286269..123286346 CCATTTTCCCAGCTGTCATAC Chr14:123286343..123286363 59.44 47.62
downstream ENSMUSE00000479827 Chr14:123288709..123289166 GGAGACGCCAGTTAAAGCAG Chr14:123288832..123288851 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGCCACACTGCCTCCTAC Chr14:123195705..123195725 60.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTCGTGACTGGGAAAACC Chr14:123195724..123195744 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041650