Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31167
Trapped Gene
Ldb3 (ENSMUSG00000021798)
Vector Insertion
Chr 14: 35349750 - 35355175
Public Clones IST10258A2 (tigm) IST13846B2 (tigm) IST13351D4 (tigm) IST14605D4 (tigm)
IST13405B2 (tigm) IST13075A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000649644 (Chr14:35355054..35355174 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTCCACATGGAGGATGG Chr14:35355074..35355093 60.47 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000649644 (Chr14:35355054..35355174 -)
Downstram Exon
ENSMUSE00000649643 (Chr14:35349751..35349866 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTCCACATGGAGGATGG Chr14:35355074..35355093 60.47 55 GGGCCTCGATAAACTTGTCA Chr14:35349767..35349786 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000618015 Chr14:35401787..35401867 TGGCATTCACTCCCAGCTAT Chr14:35401845..35401864 60.62 50
upstream ENSMUSE00000415776 Chr14:35401563..35401681 ACTTCAACATGCCCCTCACT Chr14:35401572..35401591 59.58 50
upstream ENSMUSE00000561669 Chr14:35401563..35401793 TGCATAAGGGTCCTCTCACC Chr14:35401708..35401727 60.07 55
upstream ENSMUSE00000120953 Chr14:35392362..35392513 GATGGCGTCAACACAGACAC Chr14:35392431..35392450 60.17 55
upstream ENSMUSE00000120951 Chr14:35391781..35391856 CCTATTCCCATCTCCACGAC Chr14:35391827..35391846 59.36 55
upstream ENSMUSE00000120961 Chr14:35390172..35390530 TCAGTCAGCCCCAAAGTTCT Chr14:35390304..35390323 59.84 50
upstream ENSMUSE00000689603 Chr14:35386176..35386198 No primer for this exon
upstream ENSMUSE00000120968 Chr14:35384904..35385107 AGTACAACACCCCGATCAGC Chr14:35384975..35384994 60 55
upstream ENSMUSE00000649633 Chr14:35382899..35382913 No primer for this exon
upstream ENSMUSE00000649653 Chr14:35380584..35380753 GTCCTCCAACCTGCAGTCTC Chr14:35380626..35380645 59.84 60
upstream ENSMUSE00000649652 Chr14:35380043..35380079 GCAAGACCCTGATGAAGAGG Chr14:35380059..35380078 59.8 55
upstream ENSMUSE00000618013 Chr14:35374439..35375067 GAACGTAACAGCCCACGTTT Chr14:35375032..35375051 60.04 50
upstream ENSMUSE00000649651 Chr14:35368529..35368714 No primer for this exon
upstream ENSMUSE00000649648 Chr14:35365363..35365508 CCTCTGCCCATACCAGCTAC Chr14:35365442..35365461 59.72 60
upstream ENSMUSE00000649646 Chr14:35357159..35357603 CACCAGCTTATACCCCCTCA Chr14:35357443..35357462 59.95 55
upstream ENSMUSE00000649645 Chr14:35355613..35355793 ACTGCAAGACCTCCCTAGCA Chr14:35355715..35355734 60.01 55
upstream ENSMUSE00000649644 Chr14:35355054..35355174 CTCTTCCACATGGAGGATGG Chr14:35355074..35355093 60.47 55
upstream ENSMUSE00000649643 Chr14:35349751..35349866 TCAACCTGTTCAGCACCAAG Chr14:35349841..35349860 59.87 50

*** Putative Vector Insertion (Chr 14: 35349750 - 35355175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480554 Chr14:35339885..35342735 AAGGGCAGTGGTTGGTACAG Chr14:35341103..35341122 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTCTTAATCGCCTTGCAG Chr14:35352110..35352130 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAAGGTGTCTGTCCTGAA Chr14:35352192..35352212 60.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021798