Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31171
Trapped Gene
Fbxl22 (ENSMUSG00000050503)
Vector Insertion
Chr 9: 66359411 - 66362397
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) IST14038G3 (tigm)
IST14619D12 (tigm) IST13357F10 (tigm) IST13740H9 (tigm) IST15023H3 (tigm)
IST14486A9 (tigm) IST15023H3 (tigm) IST14633B1 (tigm) IST13618G8 (tigm)
IST14619D11 (tigm) IST13740H9 (tigm) IST14486A9 (tigm) IST14038G3 (tigm)
IST15017B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000352168 (Chr9:66362026..66362396 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCTCCGAGATGTGTTTGA Chr9:66362248..66362267 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000352168 (Chr9:66362026..66362396 -)
Downstram Exon
ENSMUSE00000392068 (Chr9:66359412..66359825 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCTCCGAGATGTGTTTGA Chr9:66362248..66362267 59.98 50 CAGAAGTCCACGTGCAGAGT Chr9:66359612..66359631 59.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352168 Chr9:66362026..66362396 CAGCTCCGAGATGTGTTTGA Chr9:66362248..66362267 59.98 50
upstream ENSMUSE00000392068 Chr9:66359412..66359825 CGCGCTATTAAAGGAGAGGA Chr9:66359419..66359438 59.59 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCATGTATAATCGCCTTGC Chr9:66359397..66359418 59.97 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGCGCTATTAAAGGAGAGG Chr9:66359418..66359438 61.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050503