Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31175
Trapped Gene
Slc25a44 (ENSMUSG00000050144)
Vector Insertion
Chr 3: 88214420 - 88220012
Public Clones IST12268C2 (tigm) IST14549C6 (tigm) IST11869D10 (tigm) IST11722F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673514 (Chr3:88219908..88220011 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCCTCACATTGTCTTTCA Chr3:88219989..88220008 60.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673514 (Chr3:88219908..88220011 -)
Downstram Exon
ENSMUSE00000403490 (Chr3:88214421..88216819 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCCTCACATTGTCTTTCA Chr3:88219989..88220008 60.24 45 GCAGAGCTGTCCAATCACAA Chr3:88214876..88214895 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712761 Chr3:88228650..88229061 CTGAGAAGGAAAGCGACCAC Chr3:88228895..88228914 59.99 55
upstream ENSMUSE00000720948 Chr3:88228650..88229061 CTGAGAAGGAAAGCGACCAC Chr3:88228895..88228914 59.99 55
upstream ENSMUSE00000360770 Chr3:88224423..88225060 AGGACAAACGGAACATCCAG Chr3:88225024..88225043 59.97 50
upstream ENSMUSE00000673519 Chr3:88224423..88225060 AGGACAAACGGAACATCCAG Chr3:88225024..88225043 59.97 50
upstream ENSMUSE00000673518 Chr3:88223964..88223973 No primer for this exon
upstream ENSMUSE00000673517 Chr3:88223759..88223771 No primer for this exon
upstream ENSMUSE00000673516 Chr3:88222291..88222304 No primer for this exon
upstream ENSMUSE00000673515 Chr3:88220867..88220871 No primer for this exon
upstream ENSMUSE00000363585 Chr3:88219910..88220037 CTCAGGAGTGCCCTCACATT Chr3:88219997..88220016 60.26 55
upstream ENSMUSE00000673514 Chr3:88219908..88220011 TGCCCTCACATTGTCTTTCA Chr3:88219989..88220008 60.24 45
upstream ENSMUSE00000403490 Chr3:88214421..88216819 GAAACTCGGCAAGACAGGAG Chr3:88214557..88214576 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTGCCCTCACATTGTCT Chr3:88219991..88220011 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTGCCCTCACATTGTCT Chr3:88219991..88220011 60.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050144