Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31185
Trapped Gene
Nhsl1 (ENSMUSG00000039835)
Vector Insertion
Chr 10: 18231549 - 18235834
Public Clones IST11618F1 (tigm) IST14501C1 (tigm) IST11364A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000410215 (Chr10:18231356..18231548 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCTAAAACGCCAACCTCA Chr10:18231402..18231421 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000410215 (Chr10:18231356..18231548 +)
Downstram Exon
ENSMUSE00000363998 (Chr10:18235835..18235966 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCTAAAACGCCAACCTCA Chr10:18231402..18231421 60.11 50 CCTGACGATCGAAATTCTCC Chr10:18235858..18235877 59.63 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644792 Chr10:18127481..18128320 GACGCTGGATCTTTTTCTGC Chr10:18127638..18127657 59.96 50
upstream ENSMUSE00000577217 Chr10:18189914..18189971 No primer for this exon
upstream ENSMUSE00000320434 Chr10:18192725..18192877 GCCAAGCTCAACCTCAAATC Chr10:18192847..18192866 59.82 50
upstream ENSMUSE00000421066 Chr10:18217839..18217963 GGCTGCCGAAGTTCTCAGTA Chr10:18217862..18217881 60.54 55
upstream ENSMUSE00000410215 Chr10:18231356..18231548 GACCTAAAACGCCAACCTCA Chr10:18231402..18231421 60.11 50

*** Putative Vector Insertion (Chr 10: 18231549 - 18235834) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363998 Chr10:18235835..18235966 CCTGACGATCGAAATTCTCC Chr10:18235858..18235877 59.63 50
downstream ENSMUSE00000710484 Chr10:18243597..18246848 GAGAGGGGCTAACTGCTGTG Chr10:18245909..18245928 60.01 60
downstream ENSMUSE00000713881 Chr10:18243597..18246848 GAGAGGGGCTAACTGCTGTG Chr10:18245909..18245928 60.01 60
downstream ENSMUSE00000320342 Chr10:18247342..18247474 ATACATCCACGGGGTCTGAA Chr10:18247398..18247417 60.19 50
downstream ENSMUSE00000666582 Chr10:18247342..18247474 ATACATCCACGGGGTCTGAA Chr10:18247398..18247417 60.19 50
downstream ENSMUSE00000644788 Chr10:18251074..18253695 CACGATGCCTCTCTTCCTTC Chr10:18252569..18252588 59.95 55
downstream ENSMUSE00000666581 Chr10:18251074..18253695 CACGATGCCTCTCTTCCTTC Chr10:18252569..18252588 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCGCTCTTCAGTGAATGGT Chr10:18231511..18231532 59.3 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCGCTCTTCAGTGAATGGT Chr10:18231511..18231532 59.3 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039835