Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3119
Trapped Gene
Cyfip2 (ENSMUSG00000020340)
Vector Insertion
Chr 11: 46009970 - 46012492
Public Clones CD0259 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103613 (Chr11:46012493..46012640 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103613 (Chr11:46012493..46012640 -)
Downstram Exon
ENSMUSE00000580148 (Chr11:46007360..46009969 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000248216 Chr11:46125729..46125852 No primer for this exon
upstream ENSMUSE00000712097 Chr11:46105015..46105154 No primer for this exon
upstream ENSMUSE00000720619 Chr11:46105015..46105154 No primer for this exon
upstream ENSMUSE00000248206 Chr11:46103134..46103223 No primer for this exon
upstream ENSMUSE00000592052 Chr11:46103134..46103223 No primer for this exon
upstream ENSMUSE00000476796 Chr11:46099569..46099646 No primer for this exon
upstream ENSMUSE00000592051 Chr11:46099569..46099646 No primer for this exon
upstream ENSMUSE00000475773 Chr11:46097659..46097760 No primer for this exon
upstream ENSMUSE00000592050 Chr11:46097659..46097760 No primer for this exon
upstream ENSMUSE00000248188 Chr11:46093454..46093635 No primer for this exon
upstream ENSMUSE00000592049 Chr11:46093454..46093635 No primer for this exon
upstream ENSMUSE00000103630 Chr11:46091561..46091657 No primer for this exon
upstream ENSMUSE00000592048 Chr11:46091561..46091657 No primer for this exon
upstream ENSMUSE00000103629 Chr11:46090281..46090409 No primer for this exon
upstream ENSMUSE00000592047 Chr11:46090281..46090409 No primer for this exon
upstream ENSMUSE00000103606 Chr11:46088140..46088244 No primer for this exon
upstream ENSMUSE00000592046 Chr11:46088140..46088244 No primer for this exon
upstream ENSMUSE00000103611 Chr11:46086111..46086202 No primer for this exon
upstream ENSMUSE00000592045 Chr11:46086111..46086202 No primer for this exon
upstream ENSMUSE00000343227 Chr11:46084054..46084171 No primer for this exon
upstream ENSMUSE00000362666 Chr11:46080212..46080331 No primer for this exon
upstream ENSMUSE00000510751 Chr11:46079406..46079531 No primer for this exon
upstream ENSMUSE00000103628 Chr11:46074939..46075105 No primer for this exon
upstream ENSMUSE00000103610 Chr11:46074302..46074449 No primer for this exon
upstream ENSMUSE00000580146 Chr11:46072178..46072252 No primer for this exon
upstream ENSMUSE00000103620 Chr11:46071051..46071204 No primer for this exon
upstream ENSMUSE00000103604 Chr11:46068012..46068168 No primer for this exon
upstream ENSMUSE00000662618 Chr11:46067449..46067545 No primer for this exon
upstream ENSMUSE00000103616 Chr11:46066106..46066182 No primer for this exon
upstream ENSMUSE00000103608 Chr11:46063232..46063340 No primer for this exon
upstream ENSMUSE00000248066 Chr11:46061061..46061180 No primer for this exon
upstream ENSMUSE00000248061 Chr11:46055789..46055988 No primer for this exon
upstream ENSMUSE00000103601 Chr11:46053506..46053593 No primer for this exon
upstream ENSMUSE00000103623 Chr11:46037564..46037707 No primer for this exon
upstream ENSMUSE00000463988 Chr11:46036112..46036202 No primer for this exon
upstream ENSMUSE00000103617 Chr11:46034838..46034968 No primer for this exon
upstream ENSMUSE00000103625 Chr11:46021790..46021862 No primer for this exon
upstream ENSMUSE00000103626 Chr11:46020889..46020983 No primer for this exon
upstream ENSMUSE00000469310 Chr11:46014148..46014386 No primer for this exon
upstream ENSMUSE00000103613 Chr11:46012493..46012640 No primer for this exon

*** Putative Vector Insertion (Chr 11: 46009970 - 46012492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000580148 Chr11:46007360..46009969 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGATATGGCTGGCCTGA Chr11:46012465..46012485 60.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGATATGGCTGGCCTGA Chr11:46012465..46012485 60.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020340