Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31200
Trapped Gene
Stk10 (ENSMUSG00000020272)
Vector Insertion
Chr 11: 32515907 - 32517848
Public Clones IST11935D5 (tigm) IST11271A1 (tigm) IST13928C6 (tigm) IST12161D4 (tigm)
IST13485F2 (tigm) IST10206B4 (tigm) IST12906B10 (tigm) IST10931E7 (tigm)
IST12945B5 (tigm) IST12155F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000338085 (Chr11:32515781..32515906 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000338085 (Chr11:32515781..32515906 +)
Downstram Exon
ENSMUSE00000580416 (Chr11:32517849..32517962 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662709 Chr11:32433266..32433559 No primer for this exon
upstream ENSMUSE00000252371 Chr11:32455124..32455288 No primer for this exon
upstream ENSMUSE00000252363 Chr11:32474499..32474547 No primer for this exon
upstream ENSMUSE00000102920 Chr11:32477624..32477773 No primer for this exon
upstream ENSMUSE00000102914 Chr11:32487313..32487385 No primer for this exon
upstream ENSMUSE00000102926 Chr11:32488756..32488950 No primer for this exon
upstream ENSMUSE00000361316 Chr11:32489410..32489491 No primer for this exon
upstream ENSMUSE00000346104 Chr11:32496615..32496749 No primer for this exon
upstream ENSMUSE00000252326 Chr11:32498439..32498984 No primer for this exon
upstream ENSMUSE00000662708 Chr11:32500741..32500871 No primer for this exon
upstream ENSMUSE00000662707 Chr11:32503667..32503790 No primer for this exon
upstream ENSMUSE00000351342 Chr11:32504121..32504300 No primer for this exon
upstream ENSMUSE00000384657 Chr11:32510633..32510725 No primer for this exon
upstream ENSMUSE00000333765 Chr11:32512671..32512800 No primer for this exon
upstream ENSMUSE00000361044 Chr11:32513462..32513586 No primer for this exon
upstream ENSMUSE00000345753 Chr11:32514525..32514713 No primer for this exon
upstream ENSMUSE00000338085 Chr11:32515781..32515906 No primer for this exon

*** Putative Vector Insertion (Chr 11: 32515907 - 32517848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000580416 Chr11:32517849..32517962 No primer for this exon
downstream ENSMUSE00000430070 Chr11:32522424..32524593 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTCAGAGGCCACCTAATC Chr11:32515943..32515963 60.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000020272