Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31211
Trapped Gene
2900052L18Rik (ENSMUSG00000043993)
Vector Insertion
Chr 11: 120091192 - 120092900
Public Clones IST10340D11 (tigm) IST14705D9 (tigm) IST14705D9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362970 (Chr11:120092809..120092899 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGCTTGATGAAAGGAGAT Chr11:120092867..120092886 61.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362970 (Chr11:120092809..120092899 -)
Downstram Exon
ENSMUSE00000420339 (Chr11:120091193..120092612 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGCTTGATGAAAGGAGAT Chr11:120092867..120092886 61.62 50 TCTTTTTGAAGGGACGGATG Chr11:120092053..120092072 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362970 Chr11:120092809..120092899 GCCGCTTGATGAAAGGAGAT Chr11:120092867..120092886 61.62 50
upstream ENSMUSE00000420339 Chr11:120091193..120092612 CATCCGTCCCTTCAAAAAGA Chr11:120092075..120092094 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCGGGGACGGTTTTAAT Chr11:120092845..120092865 61.6 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000043993