Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31218
Trapped Gene
Khk (ENSMUSG00000029162)
Vector Insertion
Chr 5: 31227229 - 31229060
Public Clones IST12391C9 (tigm) IST12391C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186454 (Chr5:31227112..31227228 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACTCCTGCACTGTCCTT Chr5:31227150..31227169 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186454 (Chr5:31227112..31227228 +)
Downstram Exon
ENSMUSE00000713119 (Chr5:31229061..31229195 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACTCCTGCACTGTCCTT Chr5:31227150..31227169 60.3 55 TCGGTCTGAAGGACCACATA Chr5:31229126..31229145 59.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710086 Chr5:31224206..31224380 TGGTGCTGGACATCATCAAT Chr5:31224323..31224342 59.92 45
upstream ENSMUSE00000273041 Chr5:31224268..31224380 TGGTGCTGGACATCATCAAT Chr5:31224323..31224342 59.92 45
upstream ENSMUSE00000186454 Chr5:31227112..31227228 CCAACTCCTGCACTGTCCTT Chr5:31227150..31227169 60.3 55

*** Putative Vector Insertion (Chr 5: 31227229 - 31229060) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000713119 Chr5:31229061..31229195 TCGGTCTGAAGGACCACATA Chr5:31229126..31229145 59.09 50
downstream ENSMUSE00000186455 Chr5:31229395..31229529 GTTGTTGACGATGCAGCAAG Chr5:31229497..31229516 60.46 50
downstream ENSMUSE00000186462 Chr5:31230816..31230888 GGGTCAGATCGACCTTCTCA Chr5:31230868..31230887 60.2 55
downstream ENSMUSE00000186458 Chr5:31231894..31232040 ATCTTCACCTGTTCCGATGC Chr5:31231925..31231944 60.08 50
downstream ENSMUSE00000382794 Chr5:31232921..31233009 CGACTGTACAAGCCCCTCAG Chr5:31233000..31233019 60.84 60
downstream ENSMUSE00000186460 Chr5:31233089..31233246 CCTTCGAGAGGCTGAAGATG Chr5:31233249..31233268 60.09 55
downstream ENSMUSE00000391274 Chr5:31233335..31233618 GCCTCTGAGGTATCGAGCTG Chr5:31233457..31233476 60.12 60
downstream ENSMUSE00000717706 Chr5:31233335..31233562 GCCTCTGAGGTATCGAGCTG Chr5:31233457..31233476 60.12 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr5:31227280..31227300 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCACGTTGCCGAGTAAGTT Chr5:31227217..31227237 62.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029162