Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31225
Trapped Gene
Cacna2d2 (ENSMUSG00000010066)
Vector Insertion
Chr 9: 107328466 - 107367883
Public Clones IST10885F5 (tigm) IST14904G11 (tigm) IST14511E10 (tigm) IST14150D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691566 (Chr9:107328384..107328465 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691566 (Chr9:107328384..107328465 +)
Downstram Exon
ENSMUSE00000256082 (Chr9:107367884..107368000 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716965 Chr9:107302064..107302614 No primer for this exon
upstream ENSMUSE00000720958 Chr9:107302064..107302614 No primer for this exon
upstream ENSMUSE00000256105 Chr9:107328384..107328465 No primer for this exon
upstream ENSMUSE00000691566 Chr9:107328384..107328465 No primer for this exon

*** Putative Vector Insertion (Chr 9: 107328466 - 107367883) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256082 Chr9:107367884..107368000 No primer for this exon
downstream ENSMUSE00000256055 Chr9:107399791..107399850 No primer for this exon
downstream ENSMUSE00000221005 Chr9:107408279..107408323 No primer for this exon
downstream ENSMUSE00000256015 Chr9:107411526..107411667 No primer for this exon
downstream ENSMUSE00000255996 Chr9:107414332..107414463 No primer for this exon
downstream ENSMUSE00000255983 Chr9:107414634..107414691 No primer for this exon
downstream ENSMUSE00000530155 Chr9:107415385..107415435 No primer for this exon
downstream ENSMUSE00000583323 Chr9:107415564..107415663 No primer for this exon
downstream ENSMUSE00000583322 Chr9:107415804..107415962 No primer for this exon
downstream ENSMUSE00000583321 Chr9:107416166..107416273 No primer for this exon
downstream ENSMUSE00000583320 Chr9:107416376..107416454 No primer for this exon
downstream ENSMUSE00000583319 Chr9:107416963..107417012 No primer for this exon
downstream ENSMUSE00000583318 Chr9:107417191..107417280 No primer for this exon
downstream ENSMUSE00000583317 Chr9:107417482..107417553 No primer for this exon
downstream ENSMUSE00000583316 Chr9:107417750..107417824 No primer for this exon
downstream ENSMUSE00000583315 Chr9:107419426..107419500 No primer for this exon
downstream ENSMUSE00000583314 Chr9:107419582..107419653 No primer for this exon
downstream ENSMUSE00000583313 Chr9:107419744..107419815 No primer for this exon
downstream ENSMUSE00000583312 Chr9:107419922..107419983 No primer for this exon
downstream ENSMUSE00000220998 Chr9:107420524..107420600 No primer for this exon
downstream ENSMUSE00000583281 Chr9:107421510..107421530 No primer for this exon
downstream ENSMUSE00000583310 Chr9:107424454..107424514 No primer for this exon
downstream ENSMUSE00000583309 Chr9:107426426..107426523 No primer for this exon
downstream ENSMUSE00000583308 Chr9:107426729..107426819 No primer for this exon
downstream ENSMUSE00000583307 Chr9:107426943..107427005 No primer for this exon
downstream ENSMUSE00000583306 Chr9:107427162..107427265 No primer for this exon
downstream ENSMUSE00000583305 Chr9:107427488..107427586 No primer for this exon
downstream ENSMUSE00000583304 Chr9:107427675..107427763 No primer for this exon
downstream ENSMUSE00000583303 Chr9:107427944..107427991 No primer for this exon
downstream ENSMUSE00000583302 Chr9:107428232..107428303 No primer for this exon
downstream ENSMUSE00000583301 Chr9:107428394..107428546 No primer for this exon
downstream ENSMUSE00000583300 Chr9:107428674..107428726 No primer for this exon
downstream ENSMUSE00000583299 Chr9:107428816..107428871 No primer for this exon
downstream ENSMUSE00000583298 Chr9:107429019..107429145 No primer for this exon
downstream ENSMUSE00000583297 Chr9:107429268..107429377 No primer for this exon
downstream ENSMUSE00000583266 Chr9:107429479..107429567 No primer for this exon
downstream ENSMUSE00000583296 Chr9:107429485..107429567 No primer for this exon
downstream ENSMUSE00000354967 Chr9:107429652..107431389 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAAAAACAGGGAGGCGTTG Chr9:107343450..107343470 60.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACGTGACTGGGAAAAC Chr9:107343512..107343532 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010066