Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31228
Trapped Gene
Gk5 (ENSMUSG00000041440)
Vector Insertion
Chr 9: 96041090 - 96046090
Public Clones IST12793C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000410491 (Chr9:96040958..96041089 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCACCTTAAGATTGACCTG Chr9:96041047..96041067 60.12 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000410491 (Chr9:96040958..96041089 +)
Downstram Exon
ENSMUSE00000341880 (Chr9:96046091..96046166 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCACCTTAAGATTGACCTG Chr9:96041047..96041067 60.12 47.62 ATCAATCGTCCCAAAGCAAC Chr9:96046141..96046160 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718859 Chr9:96019794..96020031 GGGTCTGGCGTTTATAGCTC Chr9:96019808..96019827 58.81 55
upstream ENSMUSE00000530954 Chr9:96019851..96020031 CTGCCACGTCTATGACCAGA Chr9:96019980..96019999 59.85 55
upstream ENSMUSE00000386347 Chr9:96029420..96029513 CTCTGGGCTCAGTTTGTTGC Chr9:96029471..96029490 60.97 55
upstream ENSMUSE00000233618 Chr9:96033808..96033883 TTGTCGGTCTTGGCATATCA Chr9:96033832..96033851 60.07 45
upstream ENSMUSE00000369922 Chr9:96038164..96038257 AAGACCTAAGGGCAGCTGAA Chr9:96038202..96038221 59.08 50
upstream ENSMUSE00000410491 Chr9:96040958..96041089 TGCCACCTTAAGATTGACCTG Chr9:96041047..96041067 60.12 47.62

*** Putative Vector Insertion (Chr 9: 96041090 - 96046090) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341880 Chr9:96046091..96046166 ATCAATCGTCCCAAAGCAAC Chr9:96046141..96046160 59.94 45
downstream ENSMUSE00000233536 Chr9:96050635..96050696 GAATAATCCGTGGCGTAGGA Chr9:96050662..96050681 59.92 50
downstream ENSMUSE00000233514 Chr9:96050854..96050927 TGGAGACCATGGTGGTTATG Chr9:96050893..96050912 59.22 50
downstream ENSMUSE00000233489 Chr9:96051155..96051215 CTGGTATAGGCACGCCAAAT Chr9:96051207..96051226 59.98 50
downstream ENSMUSE00000233470 Chr9:96053500..96053626 AGCTTCACATCTCCCGTCTC Chr9:96053564..96053583 59.41 55
downstream ENSMUSE00000233456 Chr9:96055812..96055916 AGTTCTTGCCCAATCTTCCA Chr9:96055854..96055873 59.67 45
downstream ENSMUSE00000233429 Chr9:96071879..96071973 TCCACTAAACGACGGAACAA Chr9:96071970..96071989 59.17 45
downstream ENSMUSE00000233383 Chr9:96075109..96075212 TGGAGTGCTTCAAACCCATA Chr9:96075166..96075185 59.12 45
downstream ENSMUSE00000399664 Chr9:96076649..96076708 GATGTTCGTGACGGGAATCT Chr9:96076709..96076728 59.93 50
downstream ENSMUSE00000371960 Chr9:96077838..96077971 TTGTTACACACGCCTCCATC Chr9:96077864..96077883 59.57 50
downstream ENSMUSE00000530948 Chr9:96079340..96079488 CACCTCGTATTCCTGCCACT Chr9:96079431..96079450 60.13 55
downstream ENSMUSE00000693797 Chr9:96079340..96079425 GCCACTTCTTCTGAGGCTTG Chr9:96079417..96079436 60.13 55
downstream ENSMUSE00000693795 Chr9:96079755..96079760 No primer for this exon
downstream ENSMUSE00000713790 Chr9:96082191..96085046 TCAATGTTGCAAGGTGTGGT Chr9:96082492..96082511 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr9:96044138..96044158 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGGGAACAGGGATGTAAT Chr9:96044048..96044068 61.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041440