Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31229
Trapped Gene
4931414P19Rik (ENSMUSG00000022179)
Vector Insertion
Chr 14: 55213950 - 55224746
Public Clones (sanger) IST14985E7 (tigm) IST14252C9 (tigm) IST14397A3 (tigm) IST14478F9 (tigm)
IST11548B7 (tigm) IST13902C9 (tigm) IST11274H2 (tigm) IST12793D2 (tigm)
IST11523G2 (tigm) IST13763E9 (tigm) IST10355E6 (tigm) IST14121A2 (tigm)
IST14521C11 (tigm) IST12263F4 (tigm) IST11169F2 (tigm) IST10281A8 (tigm)
IST13585E11 (tigm) IST11689D1 (tigm) IST13372A12 (tigm) IST11727G5 (tigm)
IST12505G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648788 (Chr14:55224640..55224745 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCTTGTGTGCGTTTTCC Chr14:55224676..55224695 59.7 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648788 (Chr14:55224640..55224745 -)
Downstram Exon
ENSMUSE00000376152 (Chr14:55213951..55214788 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCTTGTGTGCGTTTTCC Chr14:55224676..55224695 59.7 45 GTCCACCCGCTGGTAGATAA Chr14:55214322..55214341 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648788 Chr14:55224640..55224745 TCATCTTGTGTGCGTTTTCC Chr14:55224676..55224695 59.7 45
upstream ENSMUSE00000376152 Chr14:55213951..55214788 TGCACCGCTGATGAAGATAG Chr14:55214219..55214238 59.97 50

*** Putative Vector Insertion (Chr 14: 55213950 - 55224746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000322907 Chr14:55209959..55210276 GGGACCAGCACTCGTTGTAT Chr14:55210202..55210221 60 55
downstream ENSMUSE00000322893 Chr14:55204773..55204834 TGCACATTGTGGACCAGTTT Chr14:55204793..55204812 60.01 45
downstream ENSMUSE00000124178 Chr14:55204489..55204592 CTCCTGCTTGAGCTTTTCCA Chr14:55204510..55204529 60.65 50
downstream ENSMUSE00000124176 Chr14:55203816..55203928 TCTCGCCTCTTGGTAAGGAA Chr14:55203870..55203889 59.95 50
downstream ENSMUSE00000322863 Chr14:55202500..55203543 ACCCTGGACTGCTCTCTTCA Chr14:55202681..55202700 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGCCATACGACCTTCGAG Chr14:55215721..55215741 59.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCCATACGACCTTCGAG Chr14:55215721..55215741 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022179