Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31233
Trapped Gene
8430426H19Rik (ENSMUSG00000055228)
Vector Insertion
Chr 13: 62556335 - 62558108
Public Clones IST13578C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576351 (Chr13:62558047..62558107 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAAGCCCATAATATCGAAG Chr13:62558078..62558098 59.78 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576351 (Chr13:62558047..62558107 -)
Downstram Exon
ENSMUSE00000484388 (Chr13:62556336..62556553 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAAGCCCATAATATCGAAG Chr13:62558078..62558098 59.78 47.62 GAATCCTTTCATGCCTTTGG Chr13:62556428..62556447 59.51 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681633 Chr13:62568067..62568149 AATTGCCAGCGATCTACGAC Chr13:62568078..62568097 60.24 50
upstream ENSMUSE00000576353 Chr13:62558293..62558419 TGAGGACGTGCATGTGAACT Chr13:62558386..62558405 60.32 50
upstream ENSMUSE00000576351 Chr13:62558047..62558107 GGGAAGCCCATAATATCGAAG Chr13:62558078..62558098 59.78 47.62
upstream ENSMUSE00000484388 Chr13:62556336..62556553 GCCTTTGCTTTACATGCTCA Chr13:62556479..62556498 59.07 45

*** Putative Vector Insertion (Chr 13: 62556335 - 62558108) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000576349 Chr13:62555683..62556333 ATGACCGTATTGGGAAAAGG Chr13:62555694..62555713 58.76 45
downstream ENSMUSE00000521021 Chr13:62554834..62556553 GGATTCTGGCCCCTACAAAT Chr13:62554939..62554958 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:62558037..62558057 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000055228