Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31235
Trapped Gene
Atp1a3 (ENSMUSG00000040907)
Vector Insertion
Chr 7: 25766760 - 25772623
Public Clones IST13578C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000535958 (Chr7:25772454..25772622 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATTGTCACTGGTGTGGAG Chr7:25772458..25772477 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000535958 (Chr7:25772454..25772622 -)
Downstram Exon
ENSMUSE00000535957 (Chr7:25766761..25766915 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATTGTCACTGGTGTGGAG Chr7:25772458..25772477 60 55 CAATGCAGAGGATGGTGATG Chr7:25766756..25766775 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391135 Chr7:25790774..25790912 CACCGCTCATCAGTCTGAAC Chr7:25790806..25790825 59.42 55
upstream ENSMUSE00000662829 Chr7:25790774..25790914 CACCGCTCATCAGTCTGAAC Chr7:25790806..25790825 59.42 55
upstream ENSMUSE00000662828 Chr7:25786091..25786177 GGACCTGGATGACCTCAAGA Chr7:25786105..25786124 60.05 55
upstream ENSMUSE00000316334 Chr7:25785939..25785998 GAGGTCTGCCGGAAATACAA Chr7:25785955..25785974 60.07 50
upstream ENSMUSE00000316328 Chr7:25785596..25785799 ACCCCAGAATGGGTCAAGTT Chr7:25785708..25785727 60.61 50
upstream ENSMUSE00000535967 Chr7:25783919..25784032 TGTACCTGGGCATAGTGCTG Chr7:25784012..25784031 59.74 55
upstream ENSMUSE00000535966 Chr7:25783693..25783827 GGGAAGGTGAAAAGATGCAG Chr7:25783792..25783811 59.67 50
upstream ENSMUSE00000316303 Chr7:25782532..25782649 CCTTCTTTTCCACCAACTGC Chr7:25782539..25782558 59.71 50
upstream ENSMUSE00000535965 Chr7:25782151..25782419 ATCTTCCTCATCGGCATCAT Chr7:25782191..25782210 59.47 45
upstream ENSMUSE00000535964 Chr7:25779555..25779753 TTTGACAACCAGATCCACGA Chr7:25779581..25779600 60.09 45
upstream ENSMUSE00000598415 Chr7:25779369..25779478 GGCAGGACAACATCCCAGTA Chr7:25779375..25779394 60.92 55
upstream ENSMUSE00000316280 Chr7:25779151..25779285 CGTTCAACTCGACCAACAAA Chr7:25779157..25779176 59.73 45
upstream ENSMUSE00000316273 Chr7:25775382..25775574 GAATGCCTACCTGGAGCTTG Chr7:25775406..25775425 59.84 55
upstream ENSMUSE00000535962 Chr7:25774808..25774983 TGCCATTACTACCTGCCTGA Chr7:25774959..25774978 59.3 50
upstream ENSMUSE00000535961 Chr7:25774587..25774723 CCAAGGGTGTGGGTATCATC Chr7:25774658..25774677 60.05 55
upstream ENSMUSE00000470049 Chr7:25772997..25773147 CAGAAGCTCATCATCGTGGA Chr7:25773013..25773032 59.94 50
upstream ENSMUSE00000535958 Chr7:25772454..25772622 CCATTGTCACTGGTGTGGAG Chr7:25772458..25772477 60 55
upstream ENSMUSE00000535957 Chr7:25766761..25766915 CATCACCATCCTCTGCATTG Chr7:25766778..25766797 60.07 50

*** Putative Vector Insertion (Chr 7: 25766760 - 25772623) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000535956 Chr7:25766538..25766661 TCTTCATGATGTCGCTCTCG Chr7:25766588..25766607 60.1 50
downstream ENSMUSE00000535955 Chr7:25765570..25765715 CATTGACAGTGCGATCATCC Chr7:25765577..25765596 60.08 50
downstream ENSMUSE00000535954 Chr7:25765029..25765159 AAGACGGAGTTCCTCCTGGT Chr7:25765022..25765041 60.11 55
downstream ENSMUSE00000316221 Chr7:25764314..25764415 TCCTCAAACAAGCCGAAGAT Chr7:25764361..25764380 59.81 45
downstream ENSMUSE00000636482 Chr7:25763933..25764024 AAACTGTAGGGGAAGGCACA Chr7:25763967..25763986 59.59 50
downstream ENSMUSE00000662827 Chr7:25763192..25764024 CACAGTCGCACTTGGAAAGA Chr7:25763769..25763788 60.03 50
downstream ENSMUSE00000676681 Chr7:25763192..25763595 GGTAATCGAGGTGTGGGAGA Chr7:25763388..25763407 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACTCCCCTGCTCTAATCG Chr7:25772566..25772586 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCTCACCCTCACCCTTC Chr7:25772631..25772651 60.89 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040907