Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3124
Trapped Gene
Mcph1 (ENSMUSG00000039842)
Vector Insertion
Chr 8: 18641666 - 18668945
Public Clones CC0123 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000226106 (Chr8:18641565..18641665 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGGCCTTGTCAGACCTC Chr8:18641611..18641630 60.86 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000226106 (Chr8:18641565..18641665 +)
Downstram Exon
ENSMUSE00000226097 (Chr8:18668946..18668983 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGGCCTTGTCAGACCTC Chr8:18641611..18641630 60.86 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374723 Chr8:18595173..18595635 GGCTGTCGTGTGTCACTGAG Chr8:18595413..18595432 60.53 60
upstream ENSMUSE00000367954 Chr8:18596923..18597014 GGACGTTTGCAAAGCAACTT Chr8:18596977..18596996 60.29 45
upstream ENSMUSE00000361861 Chr8:18607279..18607397 GAAGCTGGTTTCCGTCCTCT Chr8:18607368..18607387 60.77 55
upstream ENSMUSE00000408228 Chr8:18622607..18622694 CCTGCAGTGAATACCGATGA Chr8:18622647..18622666 59.67 50
upstream ENSMUSE00000434141 Chr8:18625560..18625674 AAAGGCAAAAGGCAGCTCTA Chr8:18625654..18625673 59.25 45
upstream ENSMUSE00000226129 Chr8:18627118..18627240 ATGACGTTCCTGTCCTCCTG Chr8:18627121..18627140 60.11 55
upstream ENSMUSE00000226124 Chr8:18629546..18629635 ATGTTGGAGCAGTCTCAGCA Chr8:18629554..18629573 59.58 50
upstream ENSMUSE00000226116 Chr8:18631516..18632643 TCCTGACGTTGAGGCTTCTT Chr8:18632030..18632049 59.99 50
upstream ENSMUSE00000226106 Chr8:18641565..18641665 CACAGGCCTTGTCAGACCTC Chr8:18641611..18641630 60.86 60

*** Putative Vector Insertion (Chr 8: 18641666 - 18668945) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226097 Chr8:18668946..18668983 No primer for this exon
downstream ENSMUSE00000226089 Chr8:18671092..18671254 ACCTGGATGATGAGGGTCTG Chr8:18671118..18671137 59.92 55
downstream ENSMUSE00000226081 Chr8:18688982..18689059 AATCCAGTGGCCCAACTCTA Chr8:18689017..18689036 59.55 50
downstream ENSMUSE00000434172 Chr8:18788239..18788476 TCGGCTGATTAGCAAAGAGG Chr8:18788308..18788327 60.48 50
downstream ENSMUSE00000332013 Chr8:18801406..18803186 ACTGGGGACACCAACAAGAG Chr8:18802460..18802479 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGAGGCCAGAGTGAGAG Chr8:18668696..18668716 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTTCGTGACTGGGAAAAC Chr8:18668711..18668732 59.32 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039842