Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31247
Trapped Gene
Gsdma2 (ENSMUSG00000017211)
Vector Insertion
Chr 11: 98513945 - 98516182
Public Clones IST11905F10 (tigm) IST13740E12 (tigm) IST13199B6 (tigm) IST12981D7 (tigm)
IST14579B9 (tigm) IST11524E2 (tigm) IST12566A7 (tigm) IST10621A8 (tigm)
IST12177A12 (tigm) IST12628G11 (tigm) IST10584C6 (tigm) IST10235E3 (tigm)
IST11572E3 (tigm) IST11959A11 (tigm) IST12917A3 (tigm) IST14313A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111507 (Chr11:98513855..98513944 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111507 (Chr11:98513855..98513944 +)
Downstram Exon
ENSMUSE00000111501 (Chr11:98516183..98516337 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000111502 Chr11:98508077..98508168 No primer for this exon
upstream ENSMUSE00000502259 Chr11:98508571..98508601 No primer for this exon
upstream ENSMUSE00000715467 Chr11:98510363..98510581 No primer for this exon
upstream ENSMUSE00000718144 Chr11:98510363..98510581 No primer for this exon
upstream ENSMUSE00000648222 Chr11:98510785..98510965 No primer for this exon
upstream ENSMUSE00000648220 Chr11:98512158..98512320 No primer for this exon
upstream ENSMUSE00000648219 Chr11:98513288..98513384 No primer for this exon
upstream ENSMUSE00000111507 Chr11:98513855..98513944 No primer for this exon

*** Putative Vector Insertion (Chr 11: 98513945 - 98516182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111501 Chr11:98516183..98516337 No primer for this exon
downstream ENSMUSE00000648216 Chr11:98516805..98516919 No primer for this exon
downstream ENSMUSE00000111504 Chr11:98518538..98518611 No primer for this exon
downstream ENSMUSE00000405348 Chr11:98518827..98519278 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:98513995..98514015 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACCCTAAAATAGGAGCA Chr11:98513955..98513975 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017211