Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31250
Trapped Gene
Rabgef1 (ENSMUSG00000025340)
Vector Insertion
Chr 5: 130647765 - 130663270
Public Clones IST14511H6 (tigm) IST14742B6 (tigm) IST14708E2 (tigm) IST14168C2 (tigm)
IST14971B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712071 (Chr5:130647668..130647764 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGAGCCGAGTGACTGAAG Chr5:130647700..130647719 61.91 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712071 (Chr5:130647668..130647764 +)
Downstram Exon
ENSMUSE00000711184 (Chr5:130663271..130663456 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGAGCCGAGTGACTGAAG Chr5:130647700..130647719 61.91 60 TTCGGACTTCAGGCTCATCT Chr5:130663298..130663317 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712071 Chr5:130647668..130647764 AGGGAGCCGAGTGACTGAAG Chr5:130647700..130647719 61.91 60

*** Putative Vector Insertion (Chr 5: 130647765 - 130663270) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000714179 Chr5:130663031..130663456 TTCGGACTTCAGGCTCATCT Chr5:130663298..130663317 59.95 50
downstream ENSMUSE00000310054 Chr5:130663050..130663456 TTCGGACTTCAGGCTCATCT Chr5:130663298..130663317 59.95 50
downstream ENSMUSE00000711184 Chr5:130663271..130663456 TTCGGACTTCAGGCTCATCT Chr5:130663298..130663317 59.95 50
downstream ENSMUSE00000149942 Chr5:130666747..130666913 TGGTGACTTTTCGGGTTTTC Chr5:130666868..130666887 59.95 45
downstream ENSMUSE00000709554 Chr5:130673817..130673986 GTCCGTCTCAATGCTGGTTT Chr5:130673884..130673903 60.12 50
downstream ENSMUSE00000149947 Chr5:130673820..130673986 GTCCGTCTCAATGCTGGTTT Chr5:130673884..130673903 60.12 50
downstream ENSMUSE00000149944 Chr5:130682879..130682960 ACGGGTCTGCATTCTTTCAG Chr5:130682956..130682975 60.26 50
downstream ENSMUSE00000149946 Chr5:130684556..130684688 No primer for this exon
downstream ENSMUSE00000718174 Chr5:130684556..130684622 No primer for this exon
downstream ENSMUSE00000149948 Chr5:130686294..130686385 CATCTGAGGCGTTACCCAGT Chr5:130686324..130686343 60.13 55
downstream ENSMUSE00000149945 Chr5:130687732..130687988 GCCCTTCAGGACGATGTAGA Chr5:130687892..130687911 60.22 55
downstream ENSMUSE00000344215 Chr5:130688704..130690206 GGCCAACTCTCAGACTCCTG Chr5:130688828..130688847 59.99 60
downstream ENSMUSE00000709075 Chr5:130688704..130690212 GGCCAACTCTCAGACTCCTG Chr5:130688828..130688847 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATAATCGCCTTGCAGCAC Chr5:130662812..130662833 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTACACCCCCTCAGGATG Chr5:130659774..130659794 58.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025340