Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31258
Trapped Gene
BC053393 (ENSMUSG00000046974)
Vector Insertion
Chr 11: 46397960 - 46399701
Public Clones IST11357H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000385059 (Chr11:46397870..46397959 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGTTCTTGTGGGCACATT Chr11:46397929..46397948 60.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000385059 (Chr11:46397870..46397959 +)
Downstram Exon
ENSMUSE00000419644 (Chr11:46399702..46399738 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGTTCTTGTGGGCACATT Chr11:46397929..46397948 60.95 50 TTGGAGATTCTGGCCTCTTT Chr11:46399740..46399759 58.86 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000419674 Chr11:46385026..46385197 AACTCAAGGGAAGGTGTGGA Chr11:46385054..46385073 59.55 50
upstream ENSMUSE00000379003 Chr11:46388074..46388131 GTCATGGTGCTCCCTCAAGT Chr11:46388080..46388099 60.12 55
upstream ENSMUSE00000344277 Chr11:46390652..46390990 CTGCTGTCGAGTGGAAATGA Chr11:46390920..46390939 59.98 50
upstream ENSMUSE00000385059 Chr11:46397870..46397959 CTGGTTCTTGTGGGCACATT Chr11:46397929..46397948 60.95 50

*** Putative Vector Insertion (Chr 11: 46397960 - 46399701) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000419644 Chr11:46399702..46399738 TTGGAGATTCTGGCCTCTTT Chr11:46399740..46399759 58.86 45
downstream ENSMUSE00000419659 Chr11:46401399..46402733 CTGCAGGAAATATGCCCAAT Chr11:46402188..46402207 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTCTAATCGCCTTGCAG Chr11:46398005..46398025 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTCCGTGACTGGGAAAAC Chr11:46398006..46398026 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046974