Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31259
Trapped Gene
Trpc5 (ENSMUSG00000041710)
Vector Insertion
Chr X: 140816213 - 140820527
Public Clones IST11663H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254055 (ChrX:140820437..140820526 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGGCTGCAATGATAAGAAA ChrX:140820477..140820497 59.31 38.1 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254055 (ChrX:140820437..140820526 -)
Downstram Exon
ENSMUSE00000370405 (ChrX:140816214..140817736 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGGCTGCAATGATAAGAAA ChrX:140820477..140820497 59.31 38.1 TAATGCTGTTCATCGGACCA ChrX:140816470..140816489 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653257 ChrX:141122342..141122723 GAGAAGAGTTTCGGGCACTG ChrX:141122634..141122653 59.99 55
upstream ENSMUSE00000372386 ChrX:140958007..140958405 TGTGGAGAAGGGGGACTATG ChrX:140958249..140958268 59.92 55
upstream ENSMUSE00000254103 ChrX:140915503..140916024 ATTGCCTTATCAAGCGAGGA ChrX:140915759..140915778 59.81 45
upstream ENSMUSE00000544888 ChrX:140862028..140862364 CCAACAATTGCTAGCCACCT ChrX:140862325..140862344 60.13 50
upstream ENSMUSE00000254086 ChrX:140859807..140859946 TGGTGGAACCTGATGGATTT ChrX:140859865..140859884 60.17 45
upstream ENSMUSE00000254080 ChrX:140854074..140854396 TCTCGTCCAAGGGAAGAATG ChrX:140854368..140854387 60.19 50
upstream ENSMUSE00000544877 ChrX:140846155..140846350 TGAAACCCTTCAGTCGCTCT ChrX:140846325..140846344 59.99 50
upstream ENSMUSE00000254065 ChrX:140822692..140822895 GGAGGCACAACTTGAGAAGC ChrX:140822698..140822717 60 55
upstream ENSMUSE00000254062 ChrX:140822396..140822437 TGCTGACAGCCTGATACAAAA ChrX:140822409..140822429 59.48 42.86
upstream ENSMUSE00000254055 ChrX:140820437..140820526 TGTGGCTGCAATGATAAGAAA ChrX:140820477..140820497 59.31 38.1
upstream ENSMUSE00000370405 ChrX:140816214..140817736 TGGTCCGATGAACAGCATTA ChrX:140816492..140816511 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAATCCGTAATCGCCTTG ChrX:140820465..140820485 60.45 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCAGAACCGTGCCAAGAG ChrX:140817506..140817526 61.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041710