Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31261
Trapped Gene
Theg (ENSMUSG00000020317)
Vector Insertion
Chr 10: 79042683 - 79046601
Public Clones IST14711H11 (tigm) IST12279C7 (tigm) IST14114B6 (tigm) IST13441F12 (tigm)
IST10058F4 (tigm) IST14646H3 (tigm) IST11329B5 (tigm) IST12279C7 (tigm)
IST11594A3 (tigm) IST12407C4 (tigm) IST10047C3 (tigm) IST14711H11 (tigm)
IST14019A12 (tigm) IST12977F12 (tigm) IST14946G1 (tigm) IST11329B5 (tigm)
IST14019A12 (tigm) IST12828G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000317892 (Chr10:79046483..79046600 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000317892 (Chr10:79046483..79046600 -)
Downstram Exon
ENSMUSE00000317888 (Chr10:79042684..79042843 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339184 Chr10:79049525..79049850 No primer for this exon
upstream ENSMUSE00000103336 Chr10:79048976..79049095 No primer for this exon
upstream ENSMUSE00000103321 Chr10:79048649..79048720 No primer for this exon
upstream ENSMUSE00000103325 Chr10:79048138..79048199 No primer for this exon
upstream ENSMUSE00000103333 Chr10:79047436..79047505 No primer for this exon
upstream ENSMUSE00000317892 Chr10:79046483..79046600 No primer for this exon
upstream ENSMUSE00000317888 Chr10:79042684..79042843 No primer for this exon

*** Putative Vector Insertion (Chr 10: 79042683 - 79046601) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317880 Chr10:79039223..79039511 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTAATCGCCTTGCAGCAC Chr10:79046533..79046553 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTGCCTTGGCAGTCTGTG Chr10:79046555..79046575 62.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020317