Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31265
Trapped Gene
Ddc (ENSMUSG00000020182)
Vector Insertion
Chr 11: 11790340 - 11798048
Public Clones IST11712F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517817 (Chr11:11798011..11798047 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517817 (Chr11:11798011..11798047 -)
Downstram Exon
ENSMUSE00000681142 (Chr11:11790341..11790404 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517817 Chr11:11798011..11798047 No primer for this exon
upstream ENSMUSE00000681142 Chr11:11790341..11790404 No primer for this exon

*** Putative Vector Insertion (Chr 11: 11790340 - 11798048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000520659 Chr11:11780445..11780653 No primer for this exon
downstream ENSMUSE00000708796 Chr11:11780445..11780653 No primer for this exon
downstream ENSMUSE00000101526 Chr11:11776248..11776361 No primer for this exon
downstream ENSMUSE00000655479 Chr11:11775515..11775595 No primer for this exon
downstream ENSMUSE00000329914 Chr11:11773137..11773256 No primer for this exon
downstream ENSMUSE00000101542 Chr11:11764897..11765031 No primer for this exon
downstream ENSMUSE00000329897 Chr11:11763654..11763797 No primer for this exon
downstream ENSMUSE00000101608 Chr11:11746639..11746705 No primer for this exon
downstream ENSMUSE00000101620 Chr11:11739401..11739495 No primer for this exon
downstream ENSMUSE00000101616 Chr11:11735745..11735812 No primer for this exon
downstream ENSMUSE00000101613 Chr11:11729105..11729181 No primer for this exon
downstream ENSMUSE00000470789 Chr11:11724852..11724871 No primer for this exon
downstream ENSMUSE00000444751 Chr11:11722198..11722296 No primer for this exon
downstream ENSMUSE00000329824 Chr11:11719294..11719395 No primer for this exon
downstream ENSMUSE00000472083 Chr11:11715214..11715431 No primer for this exon
downstream ENSMUSE00000681137 Chr11:11714106..11714520 No primer for this exon
downstream ENSMUSE00000474889 Chr11:11714104..11714520 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGTGCATATGGCTGCTGT Chr11:11797998..11798018 59.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGTGCATATGGCTGCTGT Chr11:11797998..11798018 59.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020182