Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31266
Trapped Gene
Rab25 (ENSMUSG00000008601)
Vector Insertion
Chr 3: 88347241 - 88349179
Public Clones IST10982A8 (tigm) IST10972H8 (tigm) IST12467A3 (tigm) IST10982C10 (tigm)
IST10843B12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000567123 (Chr3:88348983..88349178 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000567123 (Chr3:88348983..88349178 -)
Downstram Exon
ENSMUSE00000567122 (Chr3:88347242..88347435 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000291599 Chr3:88351955..88352186 No primer for this exon
upstream ENSMUSE00000567123 Chr3:88348983..88349178 No primer for this exon
upstream ENSMUSE00000567122 Chr3:88347242..88347435 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88347241 - 88349179) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175608 Chr3:88346623..88346703 No primer for this exon
downstream ENSMUSE00000291563 Chr3:88345958..88346292 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTCTCTCCACTCCCTCA Chr3:88349178..88349198 59.5 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAGACCAATCTGCTGTCC Chr3:88349130..88349150 60.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008601