Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31282
Trapped Gene
Dip2c (ENSMUSG00000048264)
Vector Insertion
Chr 13: 9276313 - 9492350
Public Clones 5SE223E08 (ggtc) 3SE223E08 (ggtc) 5SD063G01 (ggtc) IST14809G5 (tigm)
IST13415B4 (tigm) IST14716E2 (tigm) IST11585H8 (tigm) IST11717A11 (tigm)
IST13027A1 (tigm) IST14752G8 (tigm) IST14739E9 (tigm) IST12607B12 (tigm)
IST11960F7 (tigm) IST12280H10 (tigm) IST13333A9 (tigm) IST13027A1 (tigm)
IST12332F1 (tigm) IST10950F2 (tigm) IST14742G5 (tigm) IST10659B12 (tigm)
IST13415B4 (tigm) IST12280H10 (tigm) IST12416E3 (tigm) IST12236E8 (tigm)
IST12236E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684802 (Chr13:9276228..9276312 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684802 (Chr13:9276228..9276312 +)
Downstram Exon
ENSMUSE00000684801 (Chr13:9492351..9492422 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684802 Chr13:9276228..9276312 No primer for this exon

*** Putative Vector Insertion (Chr 13: 9276313 - 9492350) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482344 Chr13:9492349..9492422 No primer for this exon
downstream ENSMUSE00000684801 Chr13:9492351..9492422 No primer for this exon
downstream ENSMUSE00000452316 Chr13:9505825..9505935 CATCTCGAGACCCTGAGGAC Chr13:9505923..9505942 59.79 60
downstream ENSMUSE00000684778 Chr13:9505825..9505935 CATCTCGAGACCCTGAGGAC Chr13:9505923..9505942 59.79 60
downstream ENSMUSE00000115147 Chr13:9532498..9532623 CAGGGATCTTCGTTTGGAAG Chr13:9532589..9532608 59.67 50
downstream ENSMUSE00000684777 Chr13:9532498..9532623 CAGGGATCTTCGTTTGGAAG Chr13:9532589..9532608 59.67 50
downstream ENSMUSE00000115125 Chr13:9535902..9536111 TGATCCAATGCTCCATGTTG Chr13:9536003..9536022 60.48 45
downstream ENSMUSE00000684776 Chr13:9535902..9536111 TGATCCAATGCTCCATGTTG Chr13:9536003..9536022 60.48 45
downstream ENSMUSE00000251820 Chr13:9549430..9549564 TGCCATACTTTGGTGCTGTC Chr13:9549540..9549559 59.72 50
downstream ENSMUSE00000684774 Chr13:9549430..9549564 TGCCATACTTTGGTGCTGTC Chr13:9549540..9549559 59.72 50
downstream ENSMUSE00000643937 Chr13:9550992..9551111 GCTTCGGTCGTTTAAGGGTA Chr13:9551063..9551082 59.22 50
downstream ENSMUSE00000684798 Chr13:9550992..9551111 GCTTCGGTCGTTTAAGGGTA Chr13:9551063..9551082 59.22 50
downstream ENSMUSE00000684773 Chr13:9552520..9552717 TAAAGAGGGTGGCCAGTTTG Chr13:9552623..9552642 60.1 50
downstream ENSMUSE00000684797 Chr13:9552520..9552717 TAAAGAGGGTGGCCAGTTTG Chr13:9552623..9552642 60.1 50
downstream ENSMUSE00000684772 Chr13:9559917..9560008 GTCTCCAGGCCGTACCATAG Chr13:9560008..9560027 59.57 60
downstream ENSMUSE00000684795 Chr13:9559917..9560008 GTCTCCAGGCCGTACCATAG Chr13:9560008..9560027 59.57 60
downstream ENSMUSE00000115140 Chr13:9562360..9562470 CAACCATAGAAGGCCACCAT Chr13:9562421..9562440 59.81 50
downstream ENSMUSE00000684771 Chr13:9562360..9562470 CAACCATAGAAGGCCACCAT Chr13:9562421..9562440 59.81 50
downstream ENSMUSE00000115141 Chr13:9567077..9567200 CAGCTTCCAAGCAAGAAACC Chr13:9567120..9567139 59.99 50
downstream ENSMUSE00000684770 Chr13:9567077..9567200 CAGCTTCCAAGCAAGAAACC Chr13:9567120..9567139 59.99 50
downstream ENSMUSE00000513357 Chr13:9567547..9567656 ACCAATCCCGAGGAGGTTTA Chr13:9567615..9567634 60.68 50
downstream ENSMUSE00000684769 Chr13:9567547..9567656 ACCAATCCCGAGGAGGTTTA Chr13:9567615..9567634 60.68 50
downstream ENSMUSE00000115135 Chr13:9567837..9567939 TATCCTCGTCACGGTCACAC Chr13:9567890..9567909 59.55 55
downstream ENSMUSE00000684768 Chr13:9567837..9567939 TATCCTCGTCACGGTCACAC Chr13:9567890..9567909 59.55 55
downstream ENSMUSE00000115133 Chr13:9570296..9570360 GAGCCCCACATCTTTCTTGA Chr13:9570345..9570364 60.19 50
downstream ENSMUSE00000684767 Chr13:9570296..9570360 GAGCCCCACATCTTTCTTGA Chr13:9570345..9570364 60.19 50
downstream ENSMUSE00000115157 Chr13:9574380..9574473 ATCAGCGAGTATGGGATGCT Chr13:9574429..9574448 59.68 50
downstream ENSMUSE00000684766 Chr13:9574380..9574473 ATCAGCGAGTATGGGATGCT Chr13:9574429..9574448 59.68 50
downstream ENSMUSE00000115137 Chr13:9574608..9574727 GCGAGGACAGGTTGACATCT Chr13:9574694..9574713 60.27 55
downstream ENSMUSE00000684764 Chr13:9574608..9574727 GCGAGGACAGGTTGACATCT Chr13:9574694..9574713 60.27 55
downstream ENSMUSE00000572019 Chr13:9576050..9576164 TCGAAGGCCTTTACTCTGGA Chr13:9576108..9576127 59.95 50
downstream ENSMUSE00000684763 Chr13:9576050..9576164 TCGAAGGCCTTTACTCTGGA Chr13:9576108..9576127 59.95 50
downstream ENSMUSE00000684762 Chr13:9583251..9583276 TTCTGAACACCTTCCATACCC Chr13:9583277..9583297 58.9 47.62
downstream ENSMUSE00000684793 Chr13:9583251..9583267 No primer for this exon
downstream ENSMUSE00000684792 Chr13:9591990..9592004 No primer for this exon
downstream ENSMUSE00000520435 Chr13:9600625..9600742 AGGCCTACATCCTGCACTGT Chr13:9600731..9600750 59.75 55
downstream ENSMUSE00000684791 Chr13:9600632..9600742 GCCTACATCCTGCACTGTGA Chr13:9600729..9600748 59.86 55
downstream ENSMUSE00000251706 Chr13:9603735..9603871 GGTCATGCCAGAGAGACCAT Chr13:9603859..9603878 60.08 55
downstream ENSMUSE00000684760 Chr13:9603735..9603871 GGTCATGCCAGAGAGACCAT Chr13:9603859..9603878 60.08 55
downstream ENSMUSE00000115134 Chr13:9605569..9605777 CATCAGGCCGTCCATCTTAC Chr13:9605694..9605713 60.48 55
downstream ENSMUSE00000684759 Chr13:9605569..9605777 CATCAGGCCGTCCATCTTAC Chr13:9605694..9605713 60.48 55
downstream ENSMUSE00000572018 Chr13:9608190..9608304 TGCTCATCCACTGGAAACTG Chr13:9608296..9608315 59.83 50
downstream ENSMUSE00000684758 Chr13:9608190..9608304 TGCTCATCCACTGGAAACTG Chr13:9608296..9608315 59.83 50
downstream ENSMUSE00000414418 Chr13:9609943..9610144 TTTGGGAAGGGTATTTGCTG Chr13:9610014..9610033 59.93 45
downstream ENSMUSE00000684757 Chr13:9609943..9610144 TTTGGGAAGGGTATTTGCTG Chr13:9610014..9610033 59.93 45
downstream ENSMUSE00000376391 Chr13:9613593..9613702 CTAGCCTGGGCAATCCTCTT Chr13:9613659..9613678 60.72 55
downstream ENSMUSE00000684754 Chr13:9613593..9613714 CTAGCCTGGGCAATCCTCTT Chr13:9613659..9613678 60.72 55
downstream ENSMUSE00000115159 Chr13:9614991..9615071 AGCAGATGGTCAGGAGTGGT Chr13:9615052..9615071 59.71 55
downstream ENSMUSE00000115148 Chr13:9621125..9621248 TCTTTTCTGCACGCTTGTGT Chr13:9621182..9621201 59.64 45
downstream ENSMUSE00000115136 Chr13:9621828..9621949 GCAATGTCGTTGCAATGTTC Chr13:9621929..9621948 60.13 45
downstream ENSMUSE00000115144 Chr13:9623003..9623114 TCTCTGGACCGAAGCAGTTT Chr13:9623067..9623086 59.99 50
downstream ENSMUSE00000251652 Chr13:9623204..9623313 AGTGTGTCAGGGTTGGAAGG Chr13:9623264..9623283 60 55
downstream ENSMUSE00000115129 Chr13:9627219..9627349 GAAGGGTAAAGCTCGCACTG Chr13:9627286..9627305 60.01 55
downstream ENSMUSE00000115127 Chr13:9633968..9634136 GCTCCATCACCGAATAGGAA Chr13:9634098..9634117 60.04 50
downstream ENSMUSE00000115145 Chr13:9636341..9636511 AAGCAAATTGCCAGGTTCAC Chr13:9636510..9636529 60.12 45
downstream ENSMUSE00000572009 Chr13:9646225..9646286 CATAGACAGTGGTGGGGTCA Chr13:9646261..9646280 59.39 55
downstream ENSMUSE00000115170 Chr13:9653849..9653906 CCCTTTCTACCAACCGGACT Chr13:9653871..9653890 60.35 55
downstream ENSMUSE00000115162 Chr13:9655883..9655957 GGGCCTTTTGTTTCTGGATT Chr13:9655935..9655954 60.3 45
downstream ENSMUSE00000572007 Chr13:9658491..9658665 AGAAAGCCCAGGTAGCCAGT Chr13:9658636..9658655 60.27 55
downstream ENSMUSE00000115153 Chr13:9661383..9661506 TGACACTTTTGTGGGCTCTG Chr13:9661502..9661521 59.87 50
downstream ENSMUSE00000618756 Chr13:9665024..9668171 GTTCCCCAACGGCTAGTACA Chr13:9666835..9666854 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTCATAATCGCCTTGCAG Chr13:9456358..9456378 59.02 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGTATGTTCGTGACTGG Chr13:9456353..9456373 59.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048264