Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31297
Trapped Gene
Rfx4 (ENSMUSG00000020037)
Vector Insertion
Chr 10: 84307110 - 84321241
Public Clones IST15077B12 (tigm) IST12325E1 (tigm) IST15077A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641338 (Chr10:84306946..84307109 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641338 (Chr10:84306946..84307109 +)
Downstram Exon
ENSMUSE00000641337 (Chr10:84321242..84321342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437360 Chr10:84218793..84219258 No primer for this exon
upstream ENSMUSE00000437352 Chr10:84242760..84242846 No primer for this exon
upstream ENSMUSE00000437349 Chr10:84261273..84261333 No primer for this exon
upstream ENSMUSE00000437343 Chr10:84277381..84277504 No primer for this exon
upstream ENSMUSE00000437341 Chr10:84298038..84298099 No primer for this exon
upstream ENSMUSE00000252574 Chr10:84300930..84301024 No primer for this exon
upstream ENSMUSE00000641342 Chr10:84302762..84302975 No primer for this exon
upstream ENSMUSE00000641339 Chr10:84303584..84303661 No primer for this exon
upstream ENSMUSE00000641338 Chr10:84306946..84307109 No primer for this exon

*** Putative Vector Insertion (Chr 10: 84307110 - 84321241) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641337 Chr10:84321242..84321342 No primer for this exon
downstream ENSMUSE00000641336 Chr10:84323243..84323301 No primer for this exon
downstream ENSMUSE00000641334 Chr10:84325988..84326132 No primer for this exon
downstream ENSMUSE00000641333 Chr10:84331097..84331191 No primer for this exon
downstream ENSMUSE00000641332 Chr10:84331590..84331707 No primer for this exon
downstream ENSMUSE00000365299 Chr10:84334864..84335249 No primer for this exon
downstream ENSMUSE00000641331 Chr10:84342915..84343034 No primer for this exon
downstream ENSMUSE00000641330 Chr10:84343558..84343719 No primer for this exon
downstream ENSMUSE00000641328 Chr10:84356945..84357107 No primer for this exon
downstream ENSMUSE00000641327 Chr10:84358702..84358840 No primer for this exon
downstream ENSMUSE00000608931 Chr10:84367700..84369281 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGTCTTTTAATCGCCTTGC Chr10:84319152..84319173 61.09 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGTAGCCAGTCTTTCGTGAC Chr10:84319146..84319167 60.45 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020037