Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31311
Trapped Gene
Dnaja3 (ENSMUSG00000004069)
Vector Insertion
Chr 16: 4687371 - 4689980
Public Clones IST13150H7 (tigm) IST10301C12 (tigm) IST13919D8 (tigm) IST10265H4 (tigm)
IST10513H1 (tigm) IST13685B4 (tigm) IST12436G1 (tigm) IST13436C5 (tigm)
IST13353C3 (tigm) IST14433E11 (tigm) IST10204G4 (tigm) IST14272G8 (tigm)
IST10880A9 (tigm) IST12799C5 (tigm) IST12969B5 (tigm) IST12748G2 (tigm)
IST10783B5 (tigm) IST12247C10 (tigm) IST13310E3 (tigm) IST13264E10 (tigm)
IST10372C3 (tigm) IST13265B1 (tigm) IST10280B8 (tigm) IST13239D11 (tigm)
IST13171C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000293866 (Chr16:4687237..4687370 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000293866 (Chr16:4687237..4687370 +)
Downstram Exon
ENSMUSE00000127792 (Chr16:4689981..4690064 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000293876 Chr16:4684123..4684344 No primer for this exon
upstream ENSMUSE00000707554 Chr16:4684134..4684344 No primer for this exon
upstream ENSMUSE00000293866 Chr16:4687237..4687370 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4687371 - 4689980) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127792 Chr16:4689981..4690064 No primer for this exon
downstream ENSMUSE00000293851 Chr16:4693212..4693412 No primer for this exon
downstream ENSMUSE00000293783 Chr16:4694364..4694516 No primer for this exon
downstream ENSMUSE00000127796 Chr16:4696389..4696536 No primer for this exon
downstream ENSMUSE00000127795 Chr16:4697251..4697315 No primer for this exon
downstream ENSMUSE00000127793 Chr16:4699749..4699877 No primer for this exon
downstream ENSMUSE00000127790 Chr16:4701169..4701284 No primer for this exon
downstream ENSMUSE00000127794 Chr16:4702211..4702308 No primer for this exon
downstream ENSMUSE00000127799 Chr16:4705844..4705960 No primer for this exon
downstream ENSMUSE00000564297 Chr16:4706568..4707691 No primer for this exon
downstream ENSMUSE00000704380 Chr16:4706568..4707691 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAATGCCAGCCAGAAAGAT Chr16:4687331..4687351 59.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAATGCCAGCCAGAAAGAT Chr16:4687331..4687351 59.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004069