Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31312
Trapped Gene
1110057K04Rik (ENSMUSG00000037669)
Vector Insertion
Chr 12: 8214999 - 8227405
Public Clones (sanger) IST10265H4 (tigm) IST12799C5 (tigm) IST13685B4 (tigm) IST12436G1 (tigm)
IST10783B5 (tigm) IST13353C3 (tigm) IST14433E11 (tigm) IST13264E10 (tigm)
IST14272G8 (tigm) IST10280B8 (tigm) IST13239D11 (tigm) IST13171C6 (tigm)
IST12748G2 (tigm) IST10301C12 (tigm) IST12247C10 (tigm) IST13310E3 (tigm)
IST10513H1 (tigm) IST10372C3 (tigm) IST13265B1 (tigm) IST13436C5 (tigm)
IST12230A6 (tigm) IST13150H7 (tigm) IST10204G4 (tigm) IST13919D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396424 (Chr12:8214929..8214998 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396424 (Chr12:8214929..8214998 +)
Downstram Exon
ENSMUSE00000720526 (Chr12:8227406..8227561 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGGGCCCACATTTTATGAT Chr12:8227502..8227521 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000396424 Chr12:8214929..8214998 No primer for this exon

*** Putative Vector Insertion (Chr 12: 8214999 - 8227405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000709366 Chr12:8227406..8227561 CAGGGCCCACATTTTATGAT Chr12:8227502..8227521 59.65 45
downstream ENSMUSE00000720526 Chr12:8227406..8227561 CAGGGCCCACATTTTATGAT Chr12:8227502..8227521 59.65 45
downstream ENSMUSE00000399474 Chr12:8234026..8234169 AGCGGCTCTTCATCAAAGTG Chr12:8234097..8234116 60.54 50
downstream ENSMUSE00000686781 Chr12:8234026..8234169 AGCGGCTCTTCATCAAAGTG Chr12:8234097..8234116 60.54 50
downstream ENSMUSE00000427487 Chr12:8245249..8245421 CTTCATCACGTGAAGGGTCA Chr12:8245406..8245425 59.68 50
downstream ENSMUSE00000686780 Chr12:8245249..8245421 CTTCATCACGTGAAGGGTCA Chr12:8245406..8245425 59.68 50
downstream ENSMUSE00000237629 Chr12:8275170..8275404 CAGGTATCGAAACTGGCACA Chr12:8275271..8275290 59.72 50
downstream ENSMUSE00000656104 Chr12:8275170..8275404 CAGGTATCGAAACTGGCACA Chr12:8275271..8275290 59.72 50
downstream ENSMUSE00000237621 Chr12:8282614..8282696 No primer for this exon
downstream ENSMUSE00000656102 Chr12:8288131..8288154 TCACGGCAGTGTAGAATTTCC Chr12:8288156..8288176 60.12 47.62
downstream ENSMUSE00000427502 Chr12:8290706..8292558 ACCTATTTTCTGGGCGGTCT Chr12:8290902..8290921 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACCCCAATACCTTGTGAG Chr12:8220985..8221005 60.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTCGTGACTGGGAAAACC Chr12:8221046..8221066 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037669