Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31318
Trapped Gene
Amph (ENSMUSG00000021314)
Vector Insertion
Chr 13: 19217018 - 19229404
Public Clones IST10512H10 (tigm) IST11203E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000116768 (Chr13:19216895..19217017 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000116768 (Chr13:19216895..19217017 +)
Downstram Exon
ENSMUSE00000116763 (Chr13:19229405..19229611 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323182 Chr13:19040240..19040370 No primer for this exon
upstream ENSMUSE00000323322 Chr13:19137822..19137902 No primer for this exon
upstream ENSMUSE00000323317 Chr13:19169200..19169254 No primer for this exon
upstream ENSMUSE00000323312 Chr13:19176074..19176168 No primer for this exon
upstream ENSMUSE00000116783 Chr13:19178392..19178487 No primer for this exon
upstream ENSMUSE00000116774 Chr13:19186622..19186729 No primer for this exon
upstream ENSMUSE00000116767 Chr13:19187876..19187961 No primer for this exon
upstream ENSMUSE00000116765 Chr13:19191762..19191837 No primer for this exon
upstream ENSMUSE00000116779 Chr13:19192441..19192523 No primer for this exon
upstream ENSMUSE00000116771 Chr13:19194741..19194879 No primer for this exon
upstream ENSMUSE00000350589 Chr13:19196100..19196228 No primer for this exon
upstream ENSMUSE00000116777 Chr13:19204972..19205088 No primer for this exon
upstream ENSMUSE00000116764 Chr13:19208106..19208129 No primer for this exon
upstream ENSMUSE00000116773 Chr13:19210021..19210044 No primer for this exon
upstream ENSMUSE00000116782 Chr13:19212465..19212497 No primer for this exon
upstream ENSMUSE00000344330 Chr13:19213144..19213188 No primer for this exon
upstream ENSMUSE00000116768 Chr13:19216895..19217017 No primer for this exon

*** Putative Vector Insertion (Chr 13: 19217018 - 19229404) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000116763 Chr13:19229405..19229611 No primer for this exon
downstream ENSMUSE00000116766 Chr13:19231041..19231301 No primer for this exon
downstream ENSMUSE00000116769 Chr13:19233834..19233935 No primer for this exon
downstream ENSMUSE00000338773 Chr13:19241605..19242782 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr13:19220066..19220086 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGTATCGTGACTGGGAAAA Chr13:19220062..19220083 59.04 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021314