Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3133
Trapped Gene
Plk1 (ENSMUSG00000030867)
Vector Insertion
Chr 7: 129312498 - 129312594
Public Clones DB0003 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000204492 (Chr7:129312343..129312497 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACTCAACACGCCTGATTC Chr7:129312383..129312402 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000204492 (Chr7:129312343..129312497 +)
Downstram Exon
ENSMUSE00000478737 (Chr7:129312595..129312777 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACTCAACACGCCTGATTC Chr7:129312383..129312402 59.84 50 AACCACGTTCGTAGGTAGGG Chr7:129312716..129312735 58.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395577 Chr7:129302999..129303464 ACGTCGTAGGCTTCCATGAC Chr7:129303391..129303410 60.14 55
upstream ENSMUSE00000204485 Chr7:129304050..129304218 CTTCCTGAACGAGGATCTGG Chr7:129304187..129304206 59.8 55
upstream ENSMUSE00000204489 Chr7:129305021..129305165 CTTGGCAACCAAAGTGGAAT Chr7:129305031..129305050 59.97 45
upstream ENSMUSE00000258376 Chr7:129305907..129306000 CCTTTGAGACCTCGTGCCTA Chr7:129305933..129305952 60.39 55
upstream ENSMUSE00000204494 Chr7:129307534..129307753 CCCTATTACCTGCCTCACCA Chr7:129307659..129307678 59.95 55
upstream ENSMUSE00000204486 Chr7:129311111..129311266 AGAAAGAGGAACCGGTGGTC Chr7:129311144..129311163 60.49 55
upstream ENSMUSE00000204481 Chr7:129312080..129312157 GCAAGTGGGTGGACTATTCG Chr7:129312122..129312141 60.52 55
upstream ENSMUSE00000204492 Chr7:129312343..129312497 TGACTCAACACGCCTGATTC Chr7:129312383..129312402 59.84 50

*** Putative Vector Insertion (Chr 7: 129312498 - 129312594) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478737 Chr7:129312595..129312777 AACCACGTTCGTAGGTAGGG Chr7:129312716..129312735 58.98 55
downstream ENSMUSE00000411403 Chr7:129312901..129313387 CACCAGTCCGAAGGAGAGAG Chr7:129313129..129313148 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGGTGAGTCCTGGCTGT Chr7:129312494..129312514 58.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGGTGAGTCCTGGCTGT Chr7:129312494..129312514 58.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030867