Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31331
Trapped Gene
Mast1 (ENSMUSG00000053693)
Vector Insertion
Chr 8: 87439578 - 87440285
Public Clones (sanger) IST10415E11 (tigm) IST13922E8 (tigm) IST13922E8 (tigm) IST10443E5 (tigm)
IST14348E4 (tigm) IST13172E8 (tigm) IST12487H12 (tigm) IST12487H12 (tigm)
IST14348E4 (tigm) IST12507F2 (tigm) IST13351D5 (tigm) IST10301E10 (tigm)
IST11556G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000507509 (Chr8:87440055..87440284 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTCTACATGGGCGACTCC Chr8:87440085..87440104 60.54 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000507509 (Chr8:87440055..87440284 -)
Downstram Exon
ENSMUSE00000506540 (Chr8:87439579..87439701 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTCTACATGGGCGACTCC Chr8:87440085..87440104 60.54 60 CTCTACCACCTCAGGATGCAC Chr8:87439569..87439589 59.74 57.14

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581343 Chr8:87461094..87461252 GCTTTCCAATTTCTCGATGC Chr8:87461134..87461153 59.79 45
upstream ENSMUSE00000717225 Chr8:87461094..87461258 GCTTTCCAATTTCTCGATGC Chr8:87461134..87461153 59.79 45
upstream ENSMUSE00000485663 Chr8:87459605..87459693 GCACTTCTCCGACTCTACCG Chr8:87459636..87459655 60.01 60
upstream ENSMUSE00000581342 Chr8:87459143..87459218 CCCACTTCTCGTTTGCTTCT Chr8:87459151..87459170 59.47 50
upstream ENSMUSE00000262532 Chr8:87454719..87454797 No primer for this exon
upstream ENSMUSE00000262507 Chr8:87453121..87453281 GGACGAGCTGCACTTTCTGT Chr8:87453209..87453228 60.6 55
upstream ENSMUSE00000581341 Chr8:87452849..87452924 CCTCCTCCTACGACAACGAA Chr8:87452891..87452910 60.25 55
upstream ENSMUSE00000517557 Chr8:87452479..87452688 GGCTCATCACCACGGTCTAT Chr8:87452521..87452540 59.96 55
upstream ENSMUSE00000516793 Chr8:87449544..87449645 CTCGGAGAGCTTGGAGGTAG Chr8:87449615..87449634 59.18 60
upstream ENSMUSE00000495053 Chr8:87449308..87449440 ACATCCCCCGATACATCATC Chr8:87449342..87449361 59.44 50
upstream ENSMUSE00000494005 Chr8:87449174..87449241 No primer for this exon
upstream ENSMUSE00000496868 Chr8:87447927..87448012 ATTAGCAATGGTGCCTACGG Chr8:87447927..87447946 59.98 50
upstream ENSMUSE00000417078 Chr8:87447630..87447838 CGCCATGAAGAAGATCAACA Chr8:87447777..87447796 59.8 45
upstream ENSMUSE00000581340 Chr8:87445239..87445377 GAGATGGCGCGAATGTATTT Chr8:87445311..87445330 60.07 45
upstream ENSMUSE00000581339 Chr8:87444999..87445131 ATCAAGCTCACGGATTTTGG Chr8:87445087..87445106 60.07 45
upstream ENSMUSE00000581338 Chr8:87444696..87444861 GTGCCTTTCTTCGGGGATAC Chr8:87444728..87444747 60.83 55
upstream ENSMUSE00000713519 Chr8:87444530..87444615 TAGCCTCTTGCAGACCAACC Chr8:87444535..87444554 60.4 55
upstream ENSMUSE00000417055 Chr8:87444514..87444615 TAGCCTCTTGCAGACCAACC Chr8:87444535..87444554 60.4 55
upstream ENSMUSE00000581337 Chr8:87444259..87444381 TTCTTCCGAGACCTGGACTG Chr8:87444333..87444352 60.38 55
upstream ENSMUSE00000133882 Chr8:87442569..87442678 TCCTATGATGAGGACGACACC Chr8:87442629..87442649 59.94 52.38
upstream ENSMUSE00000417011 Chr8:87441952..87442130 CTCAGCACGAGCCTAAGACC Chr8:87442086..87442105 60.16 60
upstream ENSMUSE00000417006 Chr8:87441626..87441873 CCAAAGAGGCAGTTCAAGGA Chr8:87441660..87441679 60.37 50
upstream ENSMUSE00000468791 Chr8:87440452..87440658 TCAAGTCGGCTTCAGCTACA Chr8:87440477..87440496 59.74 50
upstream ENSMUSE00000507509 Chr8:87440055..87440284 GTGTCTACATGGGCGACTCC Chr8:87440085..87440104 60.54 60
upstream ENSMUSE00000506540 Chr8:87439579..87439701 GCATCCTGAGGTGGTAGAGC Chr8:87439590..87439609 59.83 60

*** Putative Vector Insertion (Chr 8: 87439578 - 87440285) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000262112 Chr8:87439354..87439490 CAATCCGGATGGAAGTGTTT Chr8:87439411..87439430 59.79 45
downstream ENSMUSE00000520050 Chr8:87437219..87437406 GACAAGGACCGGTTCAAAGA Chr8:87437292..87437311 60.09 50
downstream ENSMUSE00000635579 Chr8:87436989..87437140 CGGTACTGGCGGTGTAGTTT Chr8:87436995..87437014 60.05 55
downstream ENSMUSE00000635578 Chr8:87436945..87436986 GTGTGCGCTAGAGGTGACAG Chr8:87436941..87436960 59.65 60
downstream ENSMUSE00000635577 Chr8:87436899..87436943 No primer for this exon
downstream ENSMUSE00000635576 Chr8:87436874..87436897 TAGTTTGGCAGGGAAGCTCT Chr8:87436853..87436872 59.08 50
downstream ENSMUSE00000681388 Chr8:87436858..87436872 No primer for this exon
downstream ENSMUSE00000370543 Chr8:87435885..87436856 CACTGCGGGGTACATTCTTT Chr8:87436009..87436028 59.99 50
downstream ENSMUSE00000714349 Chr8:87435807..87435906 GCAGCATGGGCACTTTATTT Chr8:87435786..87435805 60.1 45
downstream ENSMUSE00000681389 Chr8:87435752..87437140 CACTGCGGGGTACATTCTTT Chr8:87436009..87436028 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTAATCGCCTTGCAGCAC Chr8:87440217..87440237 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCATGGTTTTGTGCCTGT Chr8:87440285..87440305 59.42 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053693