Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31343
Trapped Gene
Zfp52 (ENSMUSG00000051341)
Vector Insertion
Chr 17: 21675635 - 21691948
Public Clones (sanger) (sanger) IST13845B2 (tigm) IST13177D2 (tigm) IST10090H2 (tigm)
IST12387D12 (tigm) IST13898A6 (tigm) IST11838C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000380353 (Chr17:21675537..21675634 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCCTAGAAGGTGGAGAGG Chr17:21675590..21675609 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000380353 (Chr17:21675537..21675634 +)
Downstram Exon
ENSMUSE00000554398 (Chr17:21691949..21692039 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCCTAGAAGGTGGAGAGG Chr17:21675590..21675609 59.83 60 TGGCCATTTCTTCCTGTTTC Chr17:21692019..21692038 60.05 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490129 Chr17:21672503..21672797 TCGCCCAGAAATAGAGGATG Chr17:21672506..21672525 60.17 50
upstream ENSMUSE00000380353 Chr17:21675537..21675634 AGCCCTAGAAGGTGGAGAGG Chr17:21675590..21675609 59.83 60

*** Putative Vector Insertion (Chr 17: 21675635 - 21691948) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000554398 Chr17:21691949..21692039 TGGCCATTTCTTCCTGTTTC Chr17:21692019..21692038 60.05 45
downstream ENSMUSE00000554397 Chr17:21694099..21694225 CCTCTTGGGAGAAGTCCACA Chr17:21694147..21694166 60.23 55
downstream ENSMUSE00000519281 Chr17:21697013..21699565 ATGGTTTCTTTGCCGTATGC Chr17:21697582..21697601 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCAACTTCTGTCTTGAT Chr17:21684624..21684644 58.29 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCCAACTTCTGTCTTGAT Chr17:21684624..21684644 58.29 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051341