Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31344
Trapped Gene
Dnahc7l (ENSMUSG00000021879)
Vector Insertion
Chr 14: 27516914 - 27525507
Public Clones (sanger) IST11838C9 (tigm) IST13898A6 (tigm) IST14563B3 (tigm) IST14025A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251241 (Chr14:27516724..27516913 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTACCCGAGCACCTAAAG Chr14:27516809..27516828 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251241 (Chr14:27516724..27516913 +)
Downstram Exon
ENSMUSE00000251234 (Chr14:27525508..27525580 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTACCCGAGCACCTAAAG Chr14:27516809..27516828 60.12 55 CTGGAGGCTTCACAAGAACAC Chr14:27525536..27525556 59.9 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000397015 Chr14:27512898..27513101 AGACGGTCTAAGGAGCAGCA Chr14:27513061..27513080 60.16 55
upstream ENSMUSE00000339003 Chr14:27515436..27515517 AGTCTGGACAAAACCCTGGA Chr14:27515455..27515474 59.55 50
upstream ENSMUSE00000379150 Chr14:27515852..27515878 No primer for this exon
upstream ENSMUSE00000251241 Chr14:27516724..27516913 TGGTACCCGAGCACCTAAAG Chr14:27516809..27516828 60.12 55

*** Putative Vector Insertion (Chr 14: 27516914 - 27525507) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251234 Chr14:27525508..27525580 CTGGAGGCTTCACAAGAACAC Chr14:27525536..27525556 59.9 52.38
downstream ENSMUSE00000121565 Chr14:27526249..27526407 No primer for this exon
downstream ENSMUSE00000121571 Chr14:27526613..27526808 CAATCAATTGGGCCTCTAGC Chr14:27526636..27526655 59.67 50
downstream ENSMUSE00000121567 Chr14:27528622..27528810 TCCGTTCTATCAAACCCAAGA Chr14:27528795..27528815 59.56 42.86
downstream ENSMUSE00000121573 Chr14:27529601..27529757 TAACAGGCGATGACGTTCCT Chr14:27529652..27529671 60.66 50
downstream ENSMUSE00000121560 Chr14:27530464..27530555 GGTTTTCTGCCTGGAACCTC Chr14:27530535..27530554 61 55
downstream ENSMUSE00000121561 Chr14:27536039..27536217 CACTGGGGCAAAAGCATTAT Chr14:27536094..27536113 59.96 45
downstream ENSMUSE00000121563 Chr14:27537395..27537530 ACTCGTAGCGCATGGTCTCT Chr14:27537442..27537461 60.04 55
downstream ENSMUSE00000121569 Chr14:27541574..27541699 CCACAAGAGGACAGTTGCATT Chr14:27541662..27541682 60.16 47.62
downstream ENSMUSE00000383076 Chr14:27542983..27543117 CAGTTCTGCAAACTCGGTGA Chr14:27543105..27543124 60.03 50
downstream ENSMUSE00000121559 Chr14:27543341..27543534 TGAATCCGTTTCTGCAGTTG Chr14:27543381..27543400 59.84 45
downstream ENSMUSE00000356000 Chr14:27543877..27543988 AAGGTCCAGAAACCCTCCAT Chr14:27543907..27543926 59.79 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCATACACCAAGCTTCCTC Chr14:27519928..27519948 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCATACACCAAGCTTCCTC Chr14:27519928..27519948 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021879