Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31345
Trapped Gene
Mrc1 (ENSMUSG00000026712)
Vector Insertion
Chr 2: 14201612 - 14210613
Public Clones (sanger) IST11838C9 (tigm) IST13601B6 (tigm) IST10090H2 (tigm) IST13177D2 (tigm)
IST13845B2 (tigm) IST14201F10 (tigm) IST13898A6 (tigm) IST14995C2 (tigm)
IST13145G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000277515 (Chr2:14201463..14201611 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGATTGAGGCCTGAAAAAT Chr2:14201493..14201512 59.51 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000277515 (Chr2:14201463..14201611 +)
Downstram Exon
ENSMUSE00000277509 (Chr2:14210614..14210813 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGATTGAGGCCTGAAAAAT Chr2:14201493..14201512 59.51 40 CAGGAGTTGTTGTGGGCTCT Chr2:14210760..14210779 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333439 Chr2:14151041..14151200 TCCCTCATTGGAAGATCCAC Chr2:14151112..14151131 59.86 50
upstream ENSMUSE00000162070 Chr2:14159753..14160154 CTATGGAACCACGGATGACC Chr2:14160114..14160133 60.19 55
upstream ENSMUSE00000162087 Chr2:14165745..14165918 TGGAACCACCACTGACTACG Chr2:14165863..14165882 59.59 55
upstream ENSMUSE00000162091 Chr2:14170434..14170598 GGAGATCCACGAGCAAATGT Chr2:14170570..14170589 60.08 50
upstream ENSMUSE00000162081 Chr2:14178631..14178744 TGAGTGTACGCAGTGGTTGG Chr2:14178679..14178698 60.78 55
upstream ENSMUSE00000277551 Chr2:14182816..14182962 ATGCCAAGTGGGAAAATCTG Chr2:14182870..14182889 59.93 45
upstream ENSMUSE00000162065 Chr2:14187977..14188162 ACCTGGCAAGTATCCACAGC Chr2:14188103..14188122 60.14 55
upstream ENSMUSE00000162077 Chr2:14191766..14191923 AGGAGGACTGCGTGGTTATG Chr2:14191895..14191914 60.13 55
upstream ENSMUSE00000162067 Chr2:14192891..14193001 TAGTACCGGAGGGTGCAGAC Chr2:14192967..14192986 60.13 60
upstream ENSMUSE00000162075 Chr2:14197914..14198029 AAACGGCATGGGTTTTACTG Chr2:14197920..14197939 59.86 45
upstream ENSMUSE00000277515 Chr2:14201463..14201611 TGGATTGAGGCCTGAAAAAT Chr2:14201493..14201512 59.51 40

*** Putative Vector Insertion (Chr 2: 14201612 - 14210613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277509 Chr2:14210614..14210813 CAGGAGTTGTTGTGGGCTCT Chr2:14210760..14210779 60.3 55
downstream ENSMUSE00000277504 Chr2:14214146..14214273 GCCTCCAAATCACTTGCTGT Chr2:14214269..14214288 60.26 50
downstream ENSMUSE00000277497 Chr2:14215073..14215160 TCCATAGGTCAGTCCCAACC Chr2:14215124..14215143 59.78 55
downstream ENSMUSE00000277490 Chr2:14216427..14216571 TTCACCGTAAGCCCAATTTT Chr2:14216459..14216478 59.45 40
downstream ENSMUSE00000162061 Chr2:14225738..14225779 TGTCTTGTGGAGCAGGTGTG Chr2:14225782..14225801 60.94 55
downstream ENSMUSE00000277475 Chr2:14226943..14227106 CGTTGTCCATGGTTTCCTTC Chr2:14227029..14227048 60.35 50
downstream ENSMUSE00000277468 Chr2:14228091..14228158 GACTGCCCACCATTCTTGTT Chr2:14228116..14228135 59.97 50
downstream ENSMUSE00000162080 Chr2:14229514..14229614 TTTGCAAAGTTGGGTTCTCC Chr2:14229579..14229598 60.09 45
downstream ENSMUSE00000162074 Chr2:14230306..14230448 TACAAATGCCAACCTTCCTTG Chr2:14230440..14230460 59.98 42.86
downstream ENSMUSE00000162068 Chr2:14231595..14231709 CCTTTCAGTCCTTTGCAAGC Chr2:14231677..14231696 59.99 50
downstream ENSMUSE00000162082 Chr2:14236861..14237027 GGAACATGTGTTCTGCGTTG Chr2:14236944..14236963 60.16 50
downstream ENSMUSE00000162063 Chr2:14238469..14238571 TGAATTGCCACCAATCACAA Chr2:14238504..14238523 60.92 40
downstream ENSMUSE00000162073 Chr2:14240728..14240960 TTCATGCCATGGTAGCTTCA Chr2:14240834..14240853 60.22 45
downstream ENSMUSE00000162069 Chr2:14243400..14243565 TACCGCACCCTCCATCTATC Chr2:14243446..14243465 59.92 55
downstream ENSMUSE00000162083 Chr2:14246855..14247004 GCAATGGCCATAGAAAGGAA Chr2:14246943..14246962 60.04 45
downstream ENSMUSE00000277415 Chr2:14249414..14249527 AGCAGTCTCGATGGAAACCA Chr2:14249445..14249464 60.8 50
downstream ENSMUSE00000162072 Chr2:14250047..14250211 ATTATTCCAAAGGCCCGAAG Chr2:14250168..14250187 60.27 45
downstream ENSMUSE00000277403 Chr2:14251510..14251551 No primer for this exon
downstream ENSMUSE00000383536 Chr2:14252549..14253416 TGCTAAATGATCGCATGCTC Chr2:14252807..14252826 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGAGCAGGTGCAGTTTACA Chr2:14207571..14207591 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGAGCAGGTGCAGTTTACA Chr2:14207571..14207591 59.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026712