Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31346
Trapped Gene
Keg1 (ENSMUSG00000024694)
Vector Insertion
Chr 19: 12770332 - 12784086
Public Clones IST14099G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369185 (Chr19:12770283..12770331 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCTCTCTGTGTGGATACGG Chr19:12770303..12770323 59.37 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369185 (Chr19:12770283..12770331 +)
Downstram Exon
ENSMUSE00000144421 (Chr19:12784087..12784176 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCTCTCTGTGTGGATACGG Chr19:12770303..12770323 59.37 52.38 AGGACTCAGGGAGGTGCTTC Chr19:12784174..12784193 60.79 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369185 Chr19:12770283..12770331 AAGCTCTCTGTGTGGATACGG Chr19:12770303..12770323 59.37 52.38

*** Putative Vector Insertion (Chr 19: 12770332 - 12784086) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144421 Chr19:12784087..12784176 AGGACTCAGGGAGGTGCTTC Chr19:12784174..12784193 60.79 60
downstream ENSMUSE00000461151 Chr19:12785472..12785579 CTTCCTGGGGTCGAATAACA Chr19:12785580..12785599 59.93 50
downstream ENSMUSE00000514465 Chr19:12788997..12789123 ACAGTGCTTGGGATCCTTTG Chr19:12789068..12789087 60.11 50
downstream ENSMUSE00000144422 Chr19:12790388..12790559 CCCAAGTTAGTGGCTCCAAG Chr19:12790445..12790464 59.73 55
downstream ENSMUSE00000401356 Chr19:12793270..12794384 AAGGGGAGTGCAGGATAGGT Chr19:12794019..12794038 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGACCATAATCGCCTTGC Chr19:12779375..12779395 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACCACGTGACTGGGAAAA Chr19:12776377..12776397 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024694