Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31351
Trapped Gene
Inppl1 (ENSMUSG00000032737)
Vector Insertion
Chr 7: 108982288 - 108985466
Public Clones IST12369F4 (tigm) IST12124F3 (tigm) IST13566F7 (tigm) IST12369F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000450870 (Chr7:108985085..108985465 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTCCTGGTGCGAGATAG Chr7:108985121..108985140 59.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000450870 (Chr7:108985085..108985465 -)
Downstram Exon
ENSMUSE00000222909 (Chr7:108982289..108982352 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTCCTGGTGCGAGATAG Chr7:108985121..108985140 59.6 55 ACAGCCAGGAAATCCTCTCC Chr7:108982271..108982290 60.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000521099 Chr7:108986403..108986590 CCCAGTTATCGAAAGCGAGA Chr7:108986439..108986458 60.34 50
upstream ENSMUSE00000450870 Chr7:108985085..108985465 AGCTTCCTGGTGCGAGATAG Chr7:108985121..108985140 59.6 55
upstream ENSMUSE00000222909 Chr7:108982289..108982352 TGCCAGATGGAGAGGATTTC Chr7:108982301..108982320 60.16 50

*** Putative Vector Insertion (Chr 7: 108982288 - 108985466) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222900 Chr7:108982050..108982200 CTGAGGCATCTCGGTCATCT Chr7:108982028..108982047 60.37 55
downstream ENSMUSE00000222892 Chr7:108981364..108981484 AATGCTGGTAGAGCCAGAGC Chr7:108981410..108981429 59.6 55
downstream ENSMUSE00000222886 Chr7:108980989..108981129 CACGAGGTGACAAGGGTTCT Chr7:108980982..108981001 60.15 55
downstream ENSMUSE00000222875 Chr7:108980735..108980828 CTTCGACAGGATCTCCAAGC Chr7:108980764..108980783 59.95 55
downstream ENSMUSE00000222865 Chr7:108980542..108980631 AGCTTCAGCACAAGGCTCTC Chr7:108980560..108980579 59.9 55
downstream ENSMUSE00000222856 Chr7:108980327..108980425 CATGTCCTGCAGTGCCTTTA Chr7:108980380..108980399 59.86 50
downstream ENSMUSE00000222849 Chr7:108980073..108980223 CACTCAGCGTGAACTTCTGG Chr7:108980135..108980154 59.62 55
downstream ENSMUSE00000222840 Chr7:108979881..108979987 CTGGGTCCGATCTTTCTCCT Chr7:108979889..108979908 60.59 55
downstream ENSMUSE00000222837 Chr7:108979485..108979587 GCTTGGAGTGCCTGTTCTTC Chr7:108979511..108979530 60 55
downstream ENSMUSE00000222833 Chr7:108979189..108979385 ATGTCACGTTTTTGGGTGGT Chr7:108979334..108979353 60.13 45
downstream ENSMUSE00000222826 Chr7:108978567..108978684 GGTGTTGGCGATACCAGTCT Chr7:108978549..108978568 60 55
downstream ENSMUSE00000222816 Chr7:108978090..108978186 ATTCACGAAGCCAAATGAGG Chr7:108978103..108978122 60.07 45
downstream ENSMUSE00000222806 Chr7:108977668..108977806 GATCACCCAACGAGAGGAGA Chr7:108977735..108977754 60.2 55
downstream ENSMUSE00000222800 Chr7:108977463..108977562 CCTGAGCAGAGGCTCAAACT Chr7:108977493..108977512 59.74 55
downstream ENSMUSE00000222792 Chr7:108977275..108977363 TTGTGCCAAGCGTATGTGTC Chr7:108977269..108977288 60.73 50
downstream ENSMUSE00000222783 Chr7:108976918..108976999 CCATAGAATCCGGTCACACC Chr7:108976936..108976955 60.19 55
downstream ENSMUSE00000222777 Chr7:108976713..108976802 CCTCAAATGTCCCAAACACA Chr7:108976724..108976743 59.39 45
downstream ENSMUSE00000222765 Chr7:108975954..108976067 CTGTCTTCACAATGGCTTCG Chr7:108975980..108975999 59.44 50
downstream ENSMUSE00000222759 Chr7:108975765..108975853 AATTGATGTTGTCGCTGCTCT Chr7:108975781..108975801 59.9 42.86
downstream ENSMUSE00000222753 Chr7:108975268..108975355 CTGTGAGCAGGAGATGCTGA Chr7:108975276..108975295 60.29 55
downstream ENSMUSE00000222744 Chr7:108975020..108975175 TCATGGACTTGAGTGCAACC Chr7:108975124..108975143 59.68 50
downstream ENSMUSE00000222735 Chr7:108974707..108974785 TGCCTCTTGACACTGAAGGA Chr7:108974698..108974717 59.54 50
downstream ENSMUSE00000222727 Chr7:108974475..108974615 GTGGCTTTTCAGGCTCTTCA Chr7:108974517..108974536 60.52 50
downstream ENSMUSE00000450230 Chr7:108972407..108973073 TGTTTTGGCCATTTGCAGTA Chr7:108972544..108972563 60.11 40
downstream ENSMUSE00000222710 Chr7:108972027..108972160 CTCCTCATAGCGCTCCAAGC Chr7:108972046..108972065 62.46 60
downstream ENSMUSE00000222704 Chr7:108971175..108971917 GGAGGGAGGTGAAAACATCA Chr7:108971470..108971489 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCCATCATTAACCCTCTA Chr7:108985477..108985497 58.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCCATCATTAACCCTCTA Chr7:108982477..108982497 58.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032737